SimpleSearch - Line and FST details


Line specific information

 
Line ID 377G03
Vector Used pAC161
Line Availability only available from NASC (N436171)
Segregation Analysis 100:97:93
Confirmed for Hit At1g58380 At5g49190
Parent of DUPLO pair none
Parent of pair(s) 567, 4634, 4673, 8497, 10002, 13197, 69843, 69844, 69845, 69846

Gene hit At1g58380

 
Sequence (A. th genome BLAST matches underlined)
>23-K026788-022-377-G03-8409
AAGGCGGGAAACGACTAGCTGATCCCCGGTTATGAGGAGCCTCCCCTATACCTGAGTCGT
TGGGTTAAAATCTCTGAAGGAGGGCTCAAGCGAATCTATGAAAGGTTGGCCCATTCTCCT
TGACAGGCTTAACAATACAACTTGTATCGCTTCAACAAGATGATGGCTTAATAACGATTT
TTGCATGTATAGGTATGGCATCCTCCCTATATTGAGACGTATTTTGCGCACCTTTAATGT
TATTACGATTCTTTGACGAATATCTGTGTGCTTTTTTAACGATTTAATTTCTGCAAACCA
AATATTGGGCCTTTTGCTATTCTTCTTACCATTGCCCATTGTATGGGATCCTCCCTATAN
TGAGACNNATTA
GenBank Accession CR770363 [GenBank]
Graphic View Graphic view of gene At1g58380
Predicted Position of Insertion Chr1:21689274 - go to primer design
BLAST e Value 9e-41
Hit Clone Code (BAC ID) F19C14
Hit Gene Code At1g58380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S5 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770363 [GenBank]

Gene hit At5g49190

 
Sequence (A. th genome BLAST matches underlined)
>23-K017219-022-377-G03-8409
AAAAAAACACTCTGAGATACTCCTTTACACTGAGTGGAGTCTATGCATTCTGGAAACATG
TGTCTAAGCTCGAAAGGAGAGAAACACGACGTTACCTATGGGATCCTCCCTAATAGTGA
GenBank Accession CR770362 [GenBank]
Graphic View Graphic view of gene At5g49190
Predicted Position of Insertion Chr5:19943810 - go to primer design
BLAST e Value 5e-28
Hit Clone Code (BAC ID) K21P3
Hit Gene Code At5g49190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sucrose synthase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770364 [GenBank] CR770362 [GenBank]


Last Updated on 31.08.2016 09:40