SimpleSearch - Line and FST details


Line specific information

 
Line ID 380B01
Vector Used pAC161
Line Availability only available from NASC (N436397)
Segregation Analysis 100:96:91
Confirmed for Hit At1g71680
Parent of DUPLO pair none
Parent of pair(s) 12568

Gene hit At1g71680

 
Sequence (A. th genome BLAST matches underlined)
>02-K017232-022-380-B01-8409
TGATCTGAAATTTCCCGGACATGAAGCCAGTTTATCGAATTCATATGGTATTACTGCCTC
TTACCGATGTCACGGTCATGGCTGAGACCGGAGTTCGTGGTCTCCCTCCCGCATAGTCAC
GGCGTGGGTGGCAATTTTTTAAGAAATGGTTGTTTTAGTCTGATCTTACCTACACTACAA
TAAAGGCGTAATTTAACGATTCATTTGGTTCTAACAAGCGACCTGTACTTATTGCTATAA
TAATGCCATGGGCTATAACGATCTACTCGTTATGGCAAATGGTACAATTGCACGAAGCCG
ATCCACGGAAACGGCTGGACCGTTACCCCGAGCTATGGGATCCTCCCTAATAGTGAGATT
ATGATGGGAACATTAAGCATAGTTTTGTGACCAGATTCTGTAGTTATCTATGGGATCCCG
CCTAATAGTGAG
GenBank Accession BX004422 [GenBank]
Graphic View Graphic view of gene At1g71680
Predicted Position of Insertion Chr1:26945008 - go to primer design
BLAST e Value 2e-52
Hit Clone Code (BAC ID) F26A9
Hit Gene Code At1g71680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transmembrane amino acid transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g25590

 
Sequence (A. th genome BLAST matches underlined)
>02-K017222-022-380-B01-8409
TTTCCCGGACTGAAGCCATTTTCTTTTGCACTGTTTTTGATACCAATCCTCAAAACCTTG
CTTCTTCCGATAAACTCTCTTCGTGTTTCTTCGCATTTCTCTTTCAGTTTCATCTCCTCT
TCCTGGTGCAGCAAGATGGTTTTGATGACTGCCGCGAAAGAGGAGATAGCTGATTTGGCG
ACTTCATCGGGAAGTTTCTCAAGACGGTCATGCCATGAGTGGAGAAGAGCTTGGATTGGC
GGGCGCTGAGGCCTTGGAGGTGATGAAACTTTCTCTTTAAGACTACTCTCGATGGGGATT
AGATTTAGCTTCAGCCAGTTGTTGAGAGAGTTAATGTACTGCTTCTGATGGGGCACAAGT
GTATCGAACTGAACATGCCATTCTTCCAAGACGGTGCAGAACTGGCGAGTCTGATGGTGA
TGCTGTTTTGTGGTTTCTTTGAGAGAAGTTGAGATTTCAAGGGCCTTTAGCTCTCCAACA
ATACCTATGGG
GenBank Accession BX004421 [GenBank]
Graphic View Graphic view of gene At5g25590
Predicted Position of Insertion Chr5:8906994 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T14C9
Hit Gene Code At5g25590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA ligase (DUF630 and DUF632)
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40