SimpleSearch - Line and FST details


Line specific information

 
Line ID 380E07
Vector Used pAC161
Line Availability only available from NASC (N436439)
Segregation Analysis 100:98:78
Confirmed for Hit At1g30100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g23160

 
Sequence (A. th genome BLAST matches underlined)
>53-K017232-022-380-E07-8409
TATAGTGAGAGATCCTCCCTATAGTGAGACTCTCNACCTTGTTTTACTCATAAGCAATGA
GAGCAGACTGCTATGGGATCCTCCCTATATTGAGACGTGGGTATGAACTTGCTCCGATGC
TCATGGAATGACTTGATATGAATAGGACTTTTGTTTGTGATGATGATAATCCTTGTGAAG
ATGGAAGGGGGTCTACATTTAAGTTGAATACTGCTATGGATAACTAGCCTATGGGAAGAT
CCCTATTGAGAGAATTTAGTGAAAGAAAAAGATGAAGTTGTGAGACAGGGTGTTGAATGA
CGACCACCAGCACGAAAAGAGGACCGATGGGTGGGGAATGGAACCAGGAGACGGGGCAAG
AAATAGAAGGGGGAGGAAACCACAGACTGCACGAGGGGGGGCTGAGAAACGGAAAGGGGA
GAGAGAAGAAGAAAAAAAAAAAAAAGGGAGCAAAGGGAAAAAGGTGAAGGAGTGTGCGAG
GGGAAATAAAAGGAAGGGACAACAGGGGGGGGAGACGGACAGAGAGGAAGAGGAGCAAGA
CAGGCAGGAGGCGAGAAGGCCAGAGCAGGTGAACGGAGAGGGAAGACCGAGAAGCGGCCA
GAGGAGAACCGAAGAGATGAACAGACGACAGAGGAACGAAAAAGGAAAGGGAACAAAAAA
AAAAAGGGAAGGGGAAGAAAGGGGAAAGATGAGGAAAAACAACGAAAAAGGAAAAGGAAG
GGATAAGGGCACGGGGCAAAAACAGAAAGGAGAAACAAGCGAGTGAAAAAGAAGGAGGGG
AAAAGGGGAGGAACACAAACAATAGCAAGGAGGGGGGGAAAGGTGGCGGAAAAACCAAAA
CCGTGAAAAGCG
GenBank Accession FR809213 [GenBank]
Graphic View Graphic view of gene At3g23160
Predicted Position of Insertion Chr3:8260863 - go to primer design
BLAST e Value 4e-04
Hit Clone Code (BAC ID) K14B15
Hit Gene Code At3g23160 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF668)
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g30100

 
Sequence (A. th genome BLAST matches underlined)
>53-K017222-022-380-E07-8409
GATCATGAGATTTCCCGGACATGAGCCATTTAACATTGAATATGGCACTATATTTGCGAT
ATGGGATCCTCCCTACAGTATGAGGAACCCGAGATATTGGGACAAGAGAAACTACTCGGT
TCTCCGATTTTCCCTAAAGCTATAGGTGAGCTACATGGTCACTCTGGAATCGCACGGTTG
ATGCTATTTTACGCACGTGGTTTATTCGGTTTATTAAATCACAAAAACGGAACCGGAGTT
GCTAACGCCGGTTTGGTTTACTTCCACGACCGGTTATTAGCTATGTCTGAAGATGATCTA
CCTTACCAAGTTCGTGTCACTGACAATGGCGATTTAGAGACCATCGGAAGATTCGATTTC
GACGGACAACTAAGCTCCGCCATGATCGCTCACCCGAAGATTGATCCGGTAACGAAGGAG
CTATTTGCGTTGAGCTACGACGTCGTTAAGAAACCGTATTTGAAATACTTTAAATTCTCG
CCGGAAGGTGAGAAATCACCGGACGTTGAGATTCCTCTCGCCAGTCCGACGATGATGCAC
GATTTCGCGATCACTGAGAATTTCGTTGTGATTCCGGATCAACAAGTTGTGTTTAAGCTC
TCCGATATGTTTCTTGGGAAATCTCCGGTTAAATACGACGGAGAGAAAATTTCCCGGTTT
GGAATTTTGCCTAT
GenBank Accession BX004482 [GenBank]
Graphic View Graphic view of gene At1g30100
Predicted Position of Insertion Chr1:10571909 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2H7
Hit Gene Code At1g30100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation nine-cis-epoxycarotenoid dioxygenase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23