SimpleSearch - Line and FST details


Line specific information

 
Line ID 380E07
Vector Used pAC161
Line Availability only available from NASC (N436439)
Segregation Analysis 100:98:78
Confirmed for Hit At1g30100
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g23160 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g23160

 
Sequence (A. th genome BLAST matches underlined)
>53-K017232-022-380-E07-8409
TATAGTGAGAGATCCTCCCTATAGTGAGACTCTCNACCTTGTTTTACTCATAAGCAATGA
GAGCAGACTGCTATGGGATCCTCCCTATATTGAGACGTGGGTATGAACTTGCTCCGATGC
TCATGGAATGACTTGATATGAATAGGACTTTTGTTTGTGATGATGATAATCCTTGTGAAG
ATGGAAGGGGGTCTACATTTAAGTTGAATACTGCTATGGATAACTAGCCTATGGGAAGAT
CCCTATTGAGAGAATTTAGTGAAAGAAAAAGATGAAGTTGTGAGACAGGGTGTTGAATGA
CGACCACCAGCACGAAAAGAGGACCGATGGGTGGGGAATGGAACCAGGAGACGGGGCAAG
AAATAGAAGGGGGAGGAAACCACAGACTGCACGAGGGGGGGCTGAGAAACGGAAAGGGGA
GAGAGAAGAAGAAAAAAAAAAAAAAGGGAGCAAAGGGAAAAAGGTGAAGGAGTGTGCGAG
GGGAAATAAAAGGAAGGGACAACAGGGGGGGGAGACGGACAGAGAGGAAGAGGAGCAAGA
CAGGCAGGAGGCGAGAAGGCCAGAGCAGGTGAACGGAGAGGGAAGACCGAGAAGCGGCCA
GAGGAGAACCGAAGAGATGAACAGACGACAGAGGAACGAAAAAGGAAAGGGAACAAAAAA
AAAAAGGGAAGGGGAAGAAAGGGGAAAGATGAGGAAAAACAACGAAAAAGGAAAAGGAAG
GGATAAGGGCACGGGGCAAAAACAGAAAGGAGAAACAAGCGAGTGAAAAAGAAGGAGGGG
AAAAGGGGAGGAACACAAACAATAGCAAGGAGGGGGGGAAAGGTGGCGGAAAAACCAAAA
CCGTGAAAAGCG
GenBank Accession FR809213 [GenBank]
Graphic View Graphic view of gene At3g23160
Predicted Position of Insertion Chr3:8260863 - go to primer design
BLAST e Value 4e-04
Hit Clone Code (BAC ID) K14B15
Hit Gene Code At3g23160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant/protein (DUF668)
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 380D11

Gene hit At1g30100

 
Sequence (A. th genome BLAST matches underlined)
>53-K017222-022-380-E07-8409
GATCATGAGATTTCCCGGACATGAGCCATTTAACATTGAATATGGCACTATATTTGCGAT
ATGGGATCCTCCCTACAGTATGAGGAACCCGAGATATTGGGACAAGAGAAACTACTCGGT
TCTCCGATTTTCCCTAAAGCTATAGGTGAGCTACATGGTCACTCTGGAATCGCACGGTTG
ATGCTATTTTACGCACGTGGTTTATTCGGTTTATTAAATCACAAAAACGGAACCGGAGTT
GCTAACGCCGGTTTGGTTTACTTCCACGACCGGTTATTAGCTATGTCTGAAGATGATCTA
CCTTACCAAGTTCGTGTCACTGACAATGGCGATTTAGAGACCATCGGAAGATTCGATTTC
GACGGACAACTAAGCTCCGCCATGATCGCTCACCCGAAGATTGATCCGGTAACGAAGGAG
CTATTTGCGTTGAGCTACGACGTCGTTAAGAAACCGTATTTGAAATACTTTAAATTCTCG
CCGGAAGGTGAGAAATCACCGGACGTTGAGATTCCTCTCGCCAGTCCGACGATGATGCAC
GATTTCGCGATCACTGAGAATTTCGTTGTGATTCCGGATCAACAAGTTGTGTTTAAGCTC
TCCGATATGTTTCTTGGGAAATCTCCGGTTAAATACGACGGAGAGAAAATTTCCCGGTTT
GGAATTTTGCCTAT
GenBank Accession BX004482 [GenBank]
Graphic View Graphic view of gene At1g30100
Predicted Position of Insertion Chr1:10571909 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2H7
Hit Gene Code At1g30100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nine-cis-epoxycarotenoid dioxygenase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40