SimpleSearch - Line and FST details


Line specific information

 
Line ID 396F12
Vector Used pAC161
Line Availability only available from NASC (N437992)
Segregation Analysis 50:49:48
Confirmed for Hit At5g15730
Parent of DUPLO pair none
Parent of pair(s) 2652

Gene hit At5g15730

 
Sequence (A. th genome BLAST matches underlined)
>08-K118237-0022-396-F12C-8409
ATTGAATAATCCTGGATTTCCGTGAACTATTTTTGTATAGGTCGCGGATTTCGGGTTGTC
GAAAGAGATGGTTTTAGATAGAATGACTTCCGGATTGAAGGGTACTCACGGCTACATGGA
TCCAACATACATTTCGACTAACAAATACACGATGAAGAGCGACATTTACAGTTTCGGTGT
CATCATTCTTGAGCTCATTACTGCAATCCATCCCCAACAGAATCTGATGGAATACATCAA
CCTGGTAAGTTAAAATCCCTGGTCTATGCAACCAAACCGAATAACCCAAAAATCTGAAAT
TAAAACCCAAATCGAACCAAAACTCAGTGAGTGATTGTGAGATCAATGATTCTGTTTTTC
TGATGATCAGGCTTCGATGAGTCCAGATGGTATCGACGAAATACTCGATCAGAAACTAGT
GGGAAACGCAAGCATTGAAGAAGTGAGGTTACTGGCGAAGATTGCAAACAGGTGTGTGCA
TAAGACACCAAGAAAAAGACCATCTATTGGAGAAGTAACACAGTTCATACTAAAGATCAA
ACAAAGTCGGTCTCGAGGAAGAAGACAGGACACGATGTCTTCATCGTTTGGTGTTGGTTA
TGAGGAAGATCTGTCAAGGGTTATGAGCAGGATTAAGGATCAGCATGTTGAGTTAGGGTT
ATT
GenBank Accession HG968954 [GenBank]
Graphic View Graphic view of gene At5g15730
Predicted Position of Insertion Chr5:5132366 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F14F8
Hit Gene Code At5g15730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287071 [GenBank] HG968954 [GenBank]

Gene hit At1g41630

 
Sequence (A. th genome BLAST matches underlined)
>94-K018299-022-396-F12-8409
ACCAATTTATAGCCGCCGGCGAATTGATCGGTAAAAAAAAAAATTTCCGAGGTTTCTACA
AAGTTGGAAATCAGGATCTACCTCTTTTTGGGATCCTCCCTATAGGGAGAGTCAAAGATG
GGGAGATTGAAATCAATCTTGGAATGGATACCCGGTTACTGATTGACATCAAGAAAACTC
CAAGAAGATAAGGGGGGATGGACAAAAATTTGGGGTCCAAGGAGTGTTTACTGAACAAAG
ATTTGAAACTGTAAGAGTAGAGGAACCGAGTTTAGCTCCAACACGACCTTCAAGCTCAAC
CAGTCTTTTTAGTACGCTCTCTATAGCTGATTGGCTA
GenBank Accession BX287073 [GenBank]
Graphic View Graphic view of gene At1g41630
Predicted Position of Insertion Chr1:15473586 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) T5F23
Hit Gene Code At1g41630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 31.08.2016 09:40