SimpleSearch - Line and FST details


Line specific information

 
Line ID 406D08
Vector Used pAC161
Line Availability only available from NASC (N438924)
Segregation Analysis 50:46:37
Confirmed for Hit At2g06510
Parent of DUPLO pair none
Parent of pair(s) 12332

Gene hit At4g14720

 
Sequence (A. th genome BLAST matches underlined)
>60-K017952-022-406-D08-8409
TATCTGAGATTTCCCGGACTGAAGCCATTTACTGTGAATATATTGGCAACTCCTGGACCT
CCTCGGCCTTATAACACTTCTAGCTAAAAGAAAACGTTTCCATCTCCTTTAGTTGTGAAT
ATATCAGCTGATATCTCATTATCACACAAAACCTAGGTTATCCTCTTTTCAGATAGCTTT
GCAACGATACTTTTCTGTTCGCCTGACCCTCAACATCTTCAGAAAAGACCAACAAAAAGA
ACAATAGTTAAATTAACAGAATTTCATGGTCGTATATCATGCAGAACAAGCAAGTAGTTT
AGCGTAGCATGTAGAGGTGAAGAGGTGGACCAAATTTCGCTCTCAGGTGTTTTAAAGCAT
CATTGAATAATAGGATTTCATATCTTTAAGGTAAAATGAGTACTGTTTGTACCAGAATCA
CGAGAAGCAGGTGCCTTTTCAAGTCCATATTGGGGAAGCTCCACCATCTTCTCTGAAAAA
ATCAAATCACAATTTCAAAAAAAGGGGCACGAGGCATCTGTAGACACATAAGCTATGGGA
TC
GenBank Accession BX287934 [GenBank]
Graphic View Graphic view of gene At4g14720
Predicted Position of Insertion Chr4:8432697 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14720 [TAIR] [MIPS] [SIGnAL]
Gene Annotation TIFY domain/Divergent CCT motif family protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g06510

 
Sequence (A. th genome BLAST matches underlined)
>60-K017977-022-406-D08-8409
TGATCTGAGATTTCCCGGACATGAAGCCATTTACATTGAATATATTGGCAATTCGGGTTA
CCTCCCCTCCATCATAGTCAAGCAGATCAAACGAGAAAACCTTTCCATCTCCTTTTGCAT
TGTTATATCGTCTGATATCTCCTTTCGCAGTTACCCTATGGGATCCTCCCTATAGTGAGA
TNAAANANAAAAGGNNNTTCCCCATTTGTATCTCACTAATGAAGACGAAGCGACGTGAGA
TTTCACATGGGGGATGCAGATTTTGATGGAACGATCAATGGCAATGAGTGCGAATTTGAG
GGGAAAGCGACTAGAGCACTTATGCCTAGATGGGAAGAACTGGATGGCCGACGGGGACCA
ATTGACGAGATGAATGGGGGGCCTAGATAAGAAAATTCACGATCGGAGGGATTGATGTCC
GAGTAACAAAGGGTGGGAGACGGAGCGACGAAGGTAGAAGAGACGAAGGAAAGCGGCGGG
GCCACAAATAGATTCACGGCAACAACAGGAAGCGTAAATAGAAGGAGAACGCGAGAGACA
AGAGATACATTCCGCGGAAAAAATGTTATCCAGCAAGCGGGACCGGACGAAAAATAAGCC
CGGAAATTAATATGGTGGGCGCCCATCCCACCGGCACGTTTAATATATTCGACGTTGAGA
ACACAAATGAAAAACTAAAAAACTAGACGGCCCACGACCGGCGCCGACCACCACACAAGA
AGGAAGAATAGAGAAATGCACCGGGGGCGCCGGGGTGAAGGCGAAAGAGAAATAGCAGGC
AGTACTGTTCATAGAGAGACGAAACCTGCGCTCTCCTCAACCGCGCCGCCTCCACACACA
TTAATATATAAATAATCGTAGA
GenBank Accession BX287935 [GenBank]
Graphic View Graphic view of gene At2g06510
Predicted Position of Insertion Chr2:2586419 - go to primer design
BLAST e Value 3e-45
Hit Clone Code (BAC ID) T12H3
Hit Gene Code At2g06510 [TAIR] [MIPS] [SIGnAL]
Gene Annotation replication protein A 1A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23