SimpleSearch - Line and FST details


Line specific information

 
Line ID 445E03
Vector Used pAC161
Line Availability only available from NASC (N442675)
Segregation Analysis 60:40:29
Confirmed for Hit At5g52600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F16L1

 
Sequence (A. th genome BLAST matches underlined)
>21-K023516-022-445-E03-8409
AATTTGGAGTATAATCTCGCACAGAAGCATTTACAATTGAATATATCCTGTAGCTGACGC
TAGAAGGGTTATGAGTGTACACGTGTGTGTTTTTGACCTCTTGACTTTGAATGATCTTAC
TATGGGATCCTCCCTATAGTGAGACGTATTACTCACGGGATTAGCCAGAAATGGTAGATT
CATGGGAACAACGCTGTGGGGGGGCCCATGGAAGGCGGAATATTGGGGGCGCGGGGGATA
CATGCGACTGTGCGTTGTTTTAATGCAAAAGAAAAATAGAAGACTTGAAAGTCGGTGGCT
CAGAGGTGTAAGTCGGGACCAAATGTTGAGAATAAGAGGAACAAATATGCCGTCATACGC
CAAGCAATGATTAGGAAACGTACAAGAAAAGGGGAAGGTATGGTGCAAGAGAATAACAAT
TGTAATAGAGCGAGTAGAAAAGGAAGAGAGAGAGGGGGAACGGGAGAATAAGGTTAGTAA
AAGTTATAGACTGCAGGAGGCAGCGTATATAATTTTTTAAATAAATTAGGCGCGCGGGCC
CCAGAAGGATATGTAAATTAGTATGTAAAATTAATAAAA
GenBank Accession BX891056 [GenBank]
Graphic View Graphic view of sequence BX891056 of line 445E03
Predicted Position of Insertion Chr1:7832735 - go to primer design
BLAST e Value 3e-10
Hit Clone Code (BAC ID) F16L1
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g52600

 
Sequence (A. th genome BLAST matches underlined)
>52-K033041-022-445-E03C-3144
TCCACATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACA
GGGTACCCGGGGATCAGATTTCCCGAACGGATGTGAGGACGACGTTGTTGCTGTGGTGGG
CCTTTTTCTACATTTACATTTTTTCTTTTTCTCTTCAATAATTTTAGTAGATAGTCCCCA
CATGTAAGAGTTAAAGTTGGAAACCTCAAACTTTTTGTGTATATAGTTAATAAACAGCCT
CACTCACTTGCAAAACTGTGGAAGAAAAAATAAAAGATGGAATGCAAAAGAGAAGAAGGG
AAGTCTTACGTGAAGAGAGGGTTGTGGAAACCAGAAGAAGATATGATATTAAAAAGCTAT
GTTGAGACTCATGGTGAAGGAAACTGGGCAGACATTTCTCGTAGATCCGGTTCGATTTCC
AAATTTTTGTGTTTACTAGTAAAGGGGAGATGGGATTTTGGGACATTAAAGAATTTGTGT
TTCTGCATGATGTTTTTTTCAGGGTTGAAGAGAGGAGGAAAAAGCTGTAGGCTGAGATGG
AAGAACTATCTAAGACCAAATATCAAAAGAGGAAGCATGTCACCACAAGAACAAGACCTT
ATCATCCGCATGCATAAGCTTCTTGGAAACAGGTCTTTCCT
GenBank Accession HG968978 [GenBank]
Graphic View Graphic view of gene At5g52600
Predicted Position of Insertion Chr5:21344101 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F6N7
Hit Gene Code At5g52600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 82
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891055 [GenBank]


Last Updated on 14.10.2014 10:23