SimpleSearch - Line and FST details


Line specific information

 
Line ID 469C11
Vector Used pAC161
Line Availability only available from NASC (N444963)
Segregation Analysis 50:47:46
Confirmed for Hit At1g20700
Parent of DUPLO pair none
Parent of pair(s) 11755

Gene hit At1g20700

 
Sequence (A. th genome BLAST matches underlined)
>83-K019027-022-469-C11-8409
TATACTTCATGATCTTGTCTATGGGATCCTCCCTATAGTGAGAGTCAAGGAATACCCCCC
GACCCTGGAGACTTTGAGAGTAACAATGTGAAAATTGTGCTTGCGTTTGGAATACAACTA
ACGAAATCCAAGGCTTTTTTTTTCCCAGTGTTCGACGCATAACTTAAAATCAAATTTCAT
AATGTTTTAAACATTCAAAGACAGTTTACCTACCGCTTAGATATCGATTTATCATTGCTA
AAGATATTTGTTAATATAGTTTATGATTTGCTTATATCAAACAATTCAATATATTATTAA
TGTTTATTTTCTCTATGGGATCCCCCCTATAG
GenBank Accession BX292938 [GenBank]
Graphic View Graphic view of gene At1g20700
Predicted Position of Insertion Chr1:7182889 - go to primer design
BLAST e Value 1e-90
Hit Clone Code (BAC ID) F2D10
Hit Gene Code At1g20700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WUSCHEL related homeobox 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T8P21

 
Sequence (A. th genome BLAST matches underlined)
>83-K019031-022-469-C11-8409
TGATCTGTANATTTCCCGGACTGAAGCCATTTACAATTGATATATAAAAAACATATACTT
CATGATCTTGCCTATGGGATCCTCCCTATAGTGAGACTCTCTCGCTAAACTCCATTGTTA
GCAACCTTGAGTAGCTTAGACGCGCAATTATGATCACTAAACGGTAACTATACTATGAAA
TTACGTCCTTGAGGTTGACAGGGTTGCTGTGGCAGTAGAAACACGAAGCTAAGCAAGGAA
TCACCATTGCATAATAACATTACATTCGCTCGACAGCTCTTTAATGTCGGCTAAACAAAT
AGGACACCTAAAAATATGAATTGCCATTACTTGCGCAATTAATGCTGTCACATGGCTATG
TAAAACATTAACGCCTTCAACATCAATATTGTTTTAGATGAGTACTACTATCTTTGTAAA
ATTTAGCTAGGGTTTGTAATTTATACCTATTTTGGCAATGTACTAAAATTTGTAGATCAT
TTCAGTTACTTATCCTGTAATACAATCCNTCGACACAAAAGATAGATTGTGATAGGATAT
GCCCCTTTATGTTTCCTA
GenBank Accession FR810729 [GenBank]
Graphic View Graphic view of sequence FR810729 of line 469C11
Predicted Position of Insertion Chr2:15943065 - go to primer design
BLAST e Value 2e-73
Hit Clone Code (BAC ID) T8P21
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40