SimpleSearch - Line and FST details


Line specific information

 
Line ID 481C08
Vector Used pAC161
Line Availability only available from NASC (N446112)
Segregation Analysis 50:38:24
Confirmed for Hit At2g02950
Parent of DUPLO pair 148
Parent of pair(s) none

Gene hit At2g02950

 
Sequence (A. th genome BLAST matches underlined)
>59-K019885-022-481-C08-8409
TGCTATCGCGGATACCCTCCTGTAACGAGACAAAACACTAAACATGAGCATTAATCCAAA
ACAAGAGGAGTTTGGTGATGAGAAGAAAATGGTGAAGAAAGCTCCTGAAGATCCAGAGAT
TGGTGTGTTTGGAGCTGAGAAGTACTTCAATGGAGACATGGATTCAGACCAAGGTTCTAT
GGGATCCTCCCCTATAGTGAGA
GenBank Accession BX531532 [GenBank]
Graphic View Graphic view of gene At2g02950
Predicted Position of Insertion Chr2:856394 - go to primer design
BLAST e Value 9e-79
Hit Clone Code (BAC ID) T17M13
Hit Gene Code At2g02950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phytochrome kinase substrate 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531531 [GenBank]


Last Updated on 07.07.2016 14:03