SimpleSearch - Line and FST details


Line specific information

 
Line ID 485F07
Vector Used pAC161
Line Availability only available from NASC (N446531)
Segregation Analysis 50:16:11
Confirmed for Hit At1g20840
Parent of DUPLO pair none
Parent of pair(s) 3231, 6992

Gene hit At1g20840

 
Sequence (A. th genome BLAST matches underlined)
>54-K019738-022-485-F07-8409
CTCGAGTGATTCTGCCTGCATTCTGGCATCTTCGCGTGGAGACTGCCAAAAAGATTGACG
ATGCGGATCTTTAAGGATCATGCTTTCGCGTTTGCTAAGCTTCCGTGGTCGAGAGCGTAG
CCCAAGTGAGCTATTTTCGTCTCTGGGACAGGCCTATGGGATCCTCCNCTATAGTGAGAC
AAACGATCCCTTGGCTCGCCGGGGTCAACTATGGGATCCTCCCTATAGTGAGAGTGAATG
ACTCGCACTATTTCGTTTATTGGTGAATCATACTAATTCGAGGTATCCGTATTTGTACTA
ATATGAAAAAGTACTTGCTTTTTCCAATAACGCGGCGGACATCTATTTTTTTGAAATGAA
GAAAAGTCGTTTCTTACTCATTCTTCGTCACCCCATCTACATCATATAAATTGCAGAGAA
TGACAATCTCTCTTGTCTGGTGACACCNGAAAGACGAGCACCCCTCGTGATCCGAGCAGA
ACAGAACACTCACATGGACACGATGAGTGTAAGCAGCAGGCCGGAATGGACCCCGTTACT
GACCCAGAGCGTGAACCAAAAACGGGAGGGCGACGCGCGAGGGAGGAGAAAGCGCCGGGC
CGGGCGGTAAGTTACATGTGATAAGAACAGCGAGCCACATGAGAAACCCCCCCCAGGACG
CTAAACCGTACCGCAATTGGAAGCCGCGCGGTTAGCGGCAGCGTAGGGGGGTAGGTCACC
CGCGCCCGCCGCGGCGAGAGGCTAAGCCAAACACCGACACATGTAGCGAGAAACGTGACG
GGCCAGAAGCGGCGCCCGGGATGCAAAGACCGGTGGCGGGGGGAGCGCNCCTCCCGCGGG
GGGGAGAAAACAGGGCCAGAGGGCAGCCCCGGCCAGAATATACAACAACAAAAACACACA
GenBank Accession BX531995 [GenBank]
Graphic View Graphic view of gene At1g20840
Predicted Position of Insertion Chr1:7246536 - go to primer design
BLAST e Value 6e-40
Hit Clone Code (BAC ID) F2D10
Hit Gene Code At1g20840 [TAIR] [MIPS] [SIGnAL]
Gene Annotation tonoplast monosaccharide transporter1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23