SimpleSearch - Line and FST details


Line specific information

 
Line ID 493F03
Vector Used pAC161
Line Availability only available from NASC (N447295)
Segregation Analysis 50:13:11
Confirmed for Hit At5g62100
Parent of DUPLO pair none
Parent of pair(s) 3234, 6906

Gene hit At5g62100

 
Sequence (A. th genome BLAST matches underlined)
>22-K019652-022-493-F03-8409
TGATCTGTAGATTTCCGGACATGAAGCCTTTACATCACAAAGAAAGAGACTCAAAGATGT
TTCTTGATCTTTCTGGTGTCAAAGATCGTTCGAAACTTATTCTTATAGAAGATCCCATTT
CTCAGGAGAAACGTCTCCTTGAGTTGAGGAAAATCGCCACCAAAGAGAAATCATCTAAAG
CAATCTCTGATATTAGTTTCCAAGTCGAAAGACTCGCCGGACAAGTAACTTAAGAAACAT
AATTTTAAATTTTCCGGATAACAACGCTCTTGTCTCGTAACTTGAATCAGAATTGTTTTT
TTTGGTTTTTGGACTTTAGCTGTCGGCGTTTGATACAGTGATTGGTAAAGGAGGGAAAGT
TGAAGAGAAGAATCTTGAGAATTTGATGGAGATGTTGATGAATCAATTGGTCAAGCTCGA
TGCCATCTCAGGTGATGGAGACGTTAAATTGAAGAAGAAGATGCAGGTACTTAAATCATG
TTTTATTACTCACTGTTACTAATCTAATTCTTCATTTTACTTAGAATTCTATG
GenBank Accession BX532677 [GenBank]
Graphic View Graphic view of gene At5g62100
Predicted Position of Insertion Chr5:24940830 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MTG10
Hit Gene Code At5g62100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BCL-2-associated athanogene 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40