SimpleSearch - Line and FST details


Line specific information

 
Line ID 511C08
Vector Used pAC161
Line Availability only available from NASC (N448992)
Segregation Analysis 50:38:33
Confirmed for Hit At1g59580
Parent of DUPLO pair none
Parent of pair(s) 89647, 89657, 89667, 89668, 89669, 89670, 89671, 89672, 89673, 89674, 89675

Gene hit At1g61690

 
Sequence (A. th genome BLAST matches underlined)
>59-K021274-022-511-C08-8409
AGTGGGACATATTAACGTGAACCCGCTCAGGAGTTAACTCAAAGACGAATGTAAATCCTG
GCGATGATGTCCTCTTTCGAAATTGGATCACATATTCGCACAGGTGAGATCAACTTGTCC
ACGTATTGACAACCTTTGCTGAGTGCAGGTTCCACAAAACAATCCCCCACATCTCCGGCA
ATGATGCTGCTCGCTCAAAAAAACAAAGCCAACAGAAACTAAGAAAAATTAAGCAAATTC
AAAGGTTTTTGGGAGACATAGAAGAATCCAGCAAGTCACAAGTCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession BX649857 [GenBank]
Graphic View Graphic view of gene At1g61690
Predicted Position of Insertion Chr1:22786124 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) T13M11
Hit Gene Code At1g61690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphoinositide binding protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit BX534670 [GenBank]

Gene hit At1g59580

 
Sequence (A. th genome BLAST matches underlined)
>59-K021258-022-511-C08-8409
TTTGATTTTTTGATGATATTCTTAATTAGTTCCAGATTTAGAAACATGATGCATCGTCAA
ACCTGACGACTTCCTCCTTTTCCAAACTGCGTTCAGATACACCACAAACTGATTCCCCTT
GTCCACGTACTGACATCCTTTGCTGACCGTATGTTCATCGAACACACCCCCACATCTCCG
AAATGATGCTGCTCTCTCAAAAAACAAAGACCACAGAAACTAAAAAAAATTAAGCACATC
TCACGGTTTCTGCCAGACATAGAACAACTCCGCAAGTCACAAGTCTATGGCATCCTCCCT
ATAGTGAGCAATCCCAAATTTGAAAATATACCACACACAGAATTTTGAATTGCTTCCCAC
AAGTGACAATGAAAGATCGAATTTTAAATTTTCATCTTATTGTATCTCACGACAAATTAT
CACACATTCTTATTTAAACAT
GenBank Accession BX649856 [GenBank]
Graphic View Graphic view of gene At1g59580
Predicted Position of Insertion Chr1:21884765 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) T30E16
Hit Gene Code At1g59580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase homolog 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649856 [GenBank]


Last Updated on 31.08.2016 09:40