SimpleSearch - Line and FST details


Line specific information

 
Line ID 533H10
Vector Used pAC161
Line Availability only available from NASC (N451166)
Segregation Analysis 50:44:41
Confirmed for Hit At2g23760
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23760

 
Sequence (A. th genome BLAST matches underlined)
>80-K020374-022-533-H10-8409
CCATTTACATTGAATATATACTCATTGCGGACGTGAATGTCATCGTCTTTGGAGTTTGTG
CGGTTATGACAGTGAAGTTGTTTTCATTGTTGTTGGGTTTCCTGTCGTTATTGTTTCTAT
GTTGCTGTCTTCTTTGTTGTTGATGATTTTCATTTTCTTCTTCTGCTTCTTCTCTTTCTT
TTGCTTCTTGTTGATACATCTCTTCCACCATTGGTTTCCATACCCGAACCCTATGGGATC
CTCCCTATAGTGAGAACGANAGAGTCNTTACCAATTTTTTTTCAATTCAAAAATGTACAT
GTCCCCATAGCTATTATAGCNNCCNCCCACTATGGGATCCTCCCTATACTGAGCTACACT
GAGTTGGCACCCCCCATTTGGACGTGAATGTA
GenBank Accession BX546736 [GenBank]
Graphic View Graphic view of gene At2g23760
Predicted Position of Insertion Chr2:10108204 - go to primer design
BLAST e Value 1e-11
Hit Clone Code (BAC ID) F27L4
Hit Gene Code At2g23760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BEL1-like homeodomain 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03