SimpleSearch - Line and FST details


Line specific information

 
Line ID 537H11
Vector Used pAC161
Line Availability only available from NASC (N451551)
Segregation Analysis 50:28:22
Confirmed for Hit At1g01780
Parent of DUPLO pair none
Parent of pair(s) 4382, 4579, 7306, 92562, 92563

Gene hit At1g01780

 
Sequence (A. th genome BLAST matches underlined)
>41-K033040-022-537-H11C-3144
ATCCACTATCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAC
AGGGTACCCGGGGATCAGATTGTCGTTTCCCGTCGCTGACTCACTCCTCCTACGCCTCCT
TAGATAGCGTTCTCTATTGCCGACATCACTTTAACCAACTCTTCATGGAGAAAGGAAACT
ACGCTCACGTCCTCCAAGCCGCCAATCACCGTCGCACAGCCTCAGGCAACACTCTTCCAC
CGGAACCTACCGAAGACGTCGCCGTGGAGGCCAAGGAAGAGAATGGCGTTTCAGAGTCTT
GAATATCTCTTACATGAGTGTTTTTGAGTGAATGATTGAATGANGGTTGTTG
GenBank Accession HG969030 [GenBank]
Graphic View Graphic view of gene At1g01780
Predicted Position of Insertion Chr1:283874 - go to primer design
BLAST e Value 1e-140
Hit Clone Code (BAC ID) T1N6
Hit Gene Code At1g01780 [TAIR] [MIPS] [SIGnAL]
Gene Annotation gAtA type zinc finger transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX547159 [GenBank]


Last Updated on 14.10.2014 10:23