SimpleSearch - Line and FST details


Line specific information

 
Line ID 550D06
Vector Used pAC161
Line Availability only available from NASC (N452746)
Segregation Analysis 50:7:7
Confirmed for Hit At1g15960
Parent of DUPLO pair 12869
Parent of pair(s) none

Gene hit At1g15960

 
Sequence (A. th genome BLAST matches underlined)
>44-K020634-022-550-D06-8409
GGGGTTCGCTCAAATCCGGACATGAGCCATTTACATTGAATATATCCTGATATGCATATA
CTTATTCTGGTTGTCTCACAGAACGTTGTGGGTAAGTGGAGCTCAAAGCTATTTGCAATT
GCGTTGCTTGCTTCCGGTCAGAGTTCAACCATAACCGGAACATATGCTGGACAATACGTT
ATGCAGGTGATCAAACCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX547906 [GenBank]
Graphic View Graphic view of gene At1g15960
Predicted Position of Insertion Chr1:5483127 - go to primer design
BLAST e Value 8e-72
Hit Clone Code (BAC ID) T24D18
Hit Gene Code At1g15960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NRAMP metal ion transporter 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03