SimpleSearch - Line and FST details


Line specific information

 
Line ID 556E04
Vector Used pAC161
Line Availability only available from NASC (N453332)
Segregation Analysis 50:32:19
Confirmed for Hit At1g32130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g32130

 
Sequence (A. th genome BLAST matches underlined)
>29-K025925-022-556-E04-8409
TTTACACTCACGAACTTATCTTTGTTCTGGCTTTGCGCTCGTCATTATGTTCTTATCACA
GTCCGACGAGGCAAACAAATTCCCACAAACTACTTGCTAAGGATTTGGGTGATAAATGGG
TAATCATCCTTTTCCAGAACTCCAATCCCTCAAATCAAATTCAACCCTGATACTTACTGC
ATACATGATGATGCTTGTCTCGTCTCCTTTCCGGCAAAAGTACGGGACTCCTCCTCATAA
TGAGTAAAACTCCATGGTCCAGGAATTCTGTTTGAAGCTGCTTCCTGGATAACGAAAAAT
AAACGTATTACAAAACAGATTGTTAGAAAGAAACAGTATAAGATAACAGTAAGTTAGCAA
CTTACTTTCCAAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR397950 [GenBank]
Graphic View Graphic view of gene At1g32130
Predicted Position of Insertion Chr1:11560207 - go to primer design
BLAST e Value 3e-68
Hit Clone Code (BAC ID) F3C3
Hit Gene Code At1g32130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transcription elongation factor (TFIIS) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR397949 [GenBank] CR397950 [GenBank]


Last Updated on 31.08.2016 09:40