SimpleSearch - Line and FST details


Line specific information

 
Line ID 561E02
Vector Used pAC161
Line Availability only available from NASC (N453810)
Segregation Analysis 50:42:30
Confirmed for Hit At5g55650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g55650

 
Sequence (A. th genome BLAST matches underlined)
>13-K021663-022-561-E02-8409
CATTTCTTTCACAGCTGTCACTGACTGTTTTTTCTTGTAACCCTAATTTCATCTGTAGCT
TTCCTCTGTTTCTTGAACTCTCAAGGAGTCTCCTCTCTCACAATAACCATGGCAATCTTG
TTCGTCTCCTCTTCTGTTTTCTTGTTACGAATCTTCAAGGAAAAGACAAGACTATGTTTG
GCTGAGGGGTCCCAAGGAGAAGGCTACGATTATGAAGATGATGATGATGATGATGGTCTC
ATTGAGATTGATCTTGTGAGCGAAGAAGCAGAGACTATAGAGGCAATGAGAAACATTAAT
CAAAGTCGACTGAGAATTAGGATTGAAGAAGAACAAGAAGAAGATATTGATGATGTGAAT
ATGCAATAAGATAATCTTATTGAGATTGATATTTCCATTGAATCCATTAAAACACGAATG
TAATTTAGTTTAATATATCTCATGATCACACCATCGTGTAATCCCATTTTTTCATTTCAA
ATGTACAAAGGAAA
GenBank Accession BX651567 [GenBank]
Graphic View Graphic view of gene At5g55650
Predicted Position of Insertion Chr5:22536387 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MDF20
Hit Gene Code At5g55650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03