SimpleSearch - Line and FST details


Line specific information

 
Line ID 561F08
Vector Used pAC161
Line Availability only available from NASC (N453828)
Segregation Analysis 100:86:84
Confirmed for Hit At5g11510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11510

 
Sequence (A. th genome BLAST matches underlined)
>62-K021663-022-561-F08-8409
AGAAAATTGATTCCTAGCTGTCGTACTGGCCTTTTGGATCANTACCAAGCCATGCCTCTA
TGGGATCCTCCCTATAGTGAGTCCTATTAATCCCCCTTCCCGGCCGAACTTTGTTCACTC
TGCCCATCTATTACCATATATTTGATGAGCACGAATCAGAAGCAGCTCTTCTTCTTGAGT
CCAAGCTTCTTTGTTTATGGCAGGATTGAGATGATTGTGCCACCTATATCAGTAACAGCC
TTCACAGTTAAAATCTTGAAAAGAGGACAAAAACTATATAGTGCTATGGGATCCTCCCTA
TAGTGAGA
GenBank Accession BX651578 [GenBank]
Graphic View Graphic view of gene At5g11510
Predicted Position of Insertion Chr5:3681723 - go to primer design
BLAST e Value 3e-93
Hit Clone Code (BAC ID) F15N18
Hit Gene Code At5g11510 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 3r-4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23