SimpleSearch - Line and FST details


Line specific information

 
Line ID 561F08
Vector Used pAC161
Line Availability available as T3 set from NASC (N453828)
Segregation Analysis 100:86:84
Confirmed for Hit At5g11510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11510

 
Sequence (A. th genome BLAST matches underlined) 
>62-K021688-022-561-F08-8409
ATAGCACAAAACTATAGTTCAGTCCAGAAGAAACTTGATTCCTACCTGTCCTCCGGCCTT
TTGGATCCGTACCCAGCCCTGCCCCTATGGGATCCTCCCTATAGTGAGTCCTATTACTCC
CCCGGTCCCTCCGAATTGGTGCCCCCCTGGCCCCCTTGGCGCTCCCCC
GenBank Accession BX651579 [GenBank]
Graphic View Graphic view of gene At5g11510
Predicted Position of Insertion Chr5:3681762 - go to primer design
BLAST e Value 6e-14
Hit Clone Code (BAC ID) F15N18
Hit Gene Code At5g11510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 3r-4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR812330 [GenBank] FR812330 [GenBank]


Last Updated on 10.06.2021 13:37