SimpleSearch - Line and FST details


Line specific information

 
Line ID 567F08
Vector Used pGABI1
Line Availability only available from NASC (N454404)
Segregation Analysis 50:18:9
Confirmed for Hit At5g62380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g62380

 
Sequence (A. th genome BLAST matches underlined)
>62-K021133-022-567-F08-8409
CTAACCACGATGAACTACAACAATCCAAGAACAATGATGGGATCATCATCAGGCCAAGAA
TCTAACTGGTTCACGCAGCAAATGGATGTGGGGAATGGTAATTACTATCATCTTCCTGAT
CTAGAGAGTCCGAGAATGTTTCAAGGCTCATCATCATCATCACTATCATCATTACATCAG
AATGATCAAGACCCTTATGGTGTTGTATGGGATCCTCCCTATAGTGAGANNNNNNNNNNT
NCNNNNTNTTATNNNTAAACCAAGGGAACCCCCCCAAAAGGGCGGCATCTGAAGCTCTAC
TTAAACAGTTACATACACCTATATACAGAATATACGTAACGCCTAATAAATAAAAAAAGA
AGGGCAAGATCCAAAACACTTTTCGTATATTCATCATATGAGCCACAAAAATACTCATCG
TCAACAACACGAATCACGACTCTACTGCCCCTAAATACAAAACACATCAAACTTAAATAT
TTAAAATTA
GenBank Accession BX652238 [GenBank]
Graphic View Graphic view of gene At5g62380
Predicted Position of Insertion Chr5:25051258 - go to primer design
BLAST e Value 9e-78
Hit Clone Code (BAC ID) MMI9
Hit Gene Code At5g62380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC-domain protein 101
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX652238 [GenBank]


Last Updated on 31.08.2016 09:40