SimpleSearch - Line and FST details


Line specific information

 
Line ID 574E01
Vector Used pAC161
Line Availability only available from NASC (N455057)
Segregation Analysis 50:45:37
Confirmed for Hit At3g17510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g17510

 
Sequence (A. th genome BLAST matches underlined)
>05-K021121-022-574-E01-8409
GATTTTCTTACCTCAACCCCGTTCAGTGACGGCCTACTCTCCAACACCTGATATCATCCC
AATTTCTCCTATTAGTCAAATAATCTCACTAAATAGTCTATTGAACAGTGAAATAATGTT
TACGTAATAGTTAATATACCTCAGCTGTTACTGATAAACCAACTTGACCTTTCTGGTTTC
TTTCTTCTTGTTTTACTCTTAACTGAAACAAAATACAGTTTAAAGTTTATAAACCTACAG
ATTTGAAATTCCAAGTTGCTAAGGAAGAGGAAGACCATGTTGTGAAGACCCACCTTGGCA
TGTTTCTTTTGTACACTGAATCCCATTTCTGTAACGGCTGTTTCGATTTTCACCAGT
GenBank Accession BX652956 [GenBank]
Graphic View Graphic view of gene At3g17510
Predicted Position of Insertion Chr3:5989339 - go to primer design
BLAST e Value 2e-174
Hit Clone Code (BAC ID) MKP6
Hit Gene Code At3g17510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CBL-interacting protein kinase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03