SimpleSearch - Line and FST details


Line specific information

 
Line ID 600E10
Vector Used pAC161
Line Availability available as T3 set from NASC (N457562)
Segregation Analysis 50:21:21
Confirmed for Hit At5g65060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g65060

 
Sequence (A. th genome BLAST matches underlined) 
>77-K023091-022-600-E10-8409
ACATTGACGCGAGGTAGATACCCAGGTTGAGATTATTATGCCGCGTTTTTATAATTTACC
ATTTTGTAAAAGCTTCTGAATCCGGCTGTGAGT
GenBank Accession BX654239 [GenBank]
Graphic View Graphic view of gene At5g65060
Predicted Position of Insertion Chr5:25991194 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) MXK3
Hit Gene Code At5g65060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX654239 [GenBank]


Last Updated on 10.06.2021 13:37