SimpleSearch - Line and FST details


Line specific information

 
Line ID 600E10
Vector Used pAC161
Line Availability only available from NASC (N457562)
Segregation Analysis 50:21:21
Confirmed for Hit At5g65060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g65060

 
Sequence (A. th genome BLAST matches underlined)
>77-K023925-022-600-E10-8409
CCCCAGGTTGACATTATTATGCAAGCTTTTTATAATTTACAATTTTGTAAAAGCTTCTGA
ATCCGGCTGTGAGTAAGTTTATGGTGAAAGCTCAGCCGTTGATGATGGTGATTACTTGAG
CATCGAAAGAGTCTCCGCGACTTTGGGGCCCCAGCCCTTTTCCCGTCTCATTCCT
GenBank Accession BX892273 [GenBank]
Graphic View Graphic view of gene At5g65060
Predicted Position of Insertion Chr5:25991171 - go to primer design
BLAST e Value 3e-58
Hit Clone Code (BAC ID) MXK3
Hit Gene Code At5g65060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03