SimpleSearch - Line and FST details


Line specific information

 
Line ID 606B04
Vector Used pAC161
Line Availability only available from NASC (N458096)
Segregation Analysis 50:28:17
Confirmed for Hit At3g62090
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit K19P17

 
Sequence (A. th genome BLAST matches underlined)
>26-K021192-022-606-B04-8409
ACCGCCACATCCCATTGTAGTAACAAGAAGAAAACTAAGGTATCTATGGGATCCTCCCTA
TAGTGAGCTACACTGACTTGGTAACTCCCATTTGGACGTGAATGTAAACACACTCTGGGA
CCTCCCCTATATTGAGATACAGGGAAATCCCCTTTCCCAATTCGACGTAATCCCCTCCCC
CTTATTCGACCTCTCCACCATCACCTACCAATGGGCACCCACCAATCTCTGCAGCGCCCT
CTCTACTATCTCCCCCAAATCTAAGCTACCCTCCCAATCTTGACCACGAAAGGGAGCACC
CCACAGTCTCCCTATAAGGGGGAGCACTTCGAATTCATTAAAAAAAGAAAGCGAATATAA
AATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGC
AATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAA
ATGGGAGCTACCATTTCAGTGN
GenBank Accession FR813102 [GenBank]
Graphic View Graphic view of sequence FR813102 of line 606B04
Predicted Position of Insertion Chr5:21901554 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) K19P17
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g62090

 
Sequence (A. th genome BLAST matches underlined)
>26-K021194-022-606-B04-8409
TATATAACCGCCATATCACATTGTAGTAACAAGAAGAAAACGTAAGGTATCTATGGGATC
CTCCCTATAGTGAGCAACACGGGAATTCCTCCCTCCTGCTGTGCCCATGATTATCCACCC
TATTGTGAGACCCCCCCTTCATGGGTCAATCGTGAGATCCCTATTCCCATCTCAAGGTGA
TTCATTCCGATCCACGGAAGCACTACAACGACGTCACAACAACTACCATGCAAGGATCTC
CTCAAGGTTCTCTTTTTTAGTGCCGGCTTTTCTAGTTCATCCTCCATATAGATATAGGAA
AGGAGCTATCCTAATAGCACTAATAATCACGAGTACTATTTTCCTTCGAATGAATAAGAC
TGCATGTTAAAAACGTTAATAAATTATCGAACACTATCGGAGTGATAAAAATCATAACTC
GACGTTCCTCTCTGTTTATGAAACATCCTGCTGACTTTATACAATGGAGTGAAGCTATTG
TTTCTATGGGCACGTCCCCATGGTTAGCATACCAATACTCTGCTCTCTTTACC
GenBank Accession BX654374 [GenBank]
Graphic View Graphic view of gene At3g62090
Predicted Position of Insertion Chr3:22989135 - go to primer design
BLAST e Value 2e-128
Hit Clone Code (BAC ID) T17J13
Hit Gene Code At3g62090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phytochrome interacting factor 3-like 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03