SimpleSearch - Line and FST details


Line specific information

 
Line ID 609E06
Vector Used pAC161
Line Availability only available from NASC (N458422)
Segregation Analysis 50:49:44
Confirmed for Hit At4g10490
Parent of DUPLO pair none
Parent of pair(s) 3346, 9719

Gene hit At4g10490

 
Sequence (A. th genome BLAST matches underlined)
>45-K021863-022-609-E06-8409
TTAAGATTTCTCTTTGGAAACGTTGAAACTTGTGGAGAGTCTCGTTGTCTTTTTGGTATC
TGCTGAGTAATGCTTCACTCTTTCGCTCATCTGATTGCCGGAAAAACTCTCTTGCCGCAT
TCATCATTTTTTTGATCGTTTCTTCTGGTACTCCATGGTTCTTGATCTGGAACAGAGGAA
ACAAATCTATGGGATCCTCCCTATAGTGAGACGTATTACTCACCGGTTTCAACTTATTTG
GAGACCCACTAGCATATGCCCTCTACGTTATTATAGNAAGTGTGCTCTGAATTCCACCTA
TGGAAAAGTGAGGATCACCGCGATATAAAAGGAAAAAGGACAAACCAATTAAAGAATGAC
AGAGAGCATAAA
GenBank Accession BX655923 [GenBank]
Graphic View Graphic view of gene At4g10490
Predicted Position of Insertion Chr4:6484425 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) F7L13
Hit Gene Code At4g10490 [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T9A21

 
Sequence (A. th genome BLAST matches underlined)
>45-K021864-022-609-E06-8409
AAAAAATGAATTACACATTCAAACCAGAAAACCCTATATCTGTTCCACACGTATAAATTA
TAATGGAAACTGATTGAACTATCACTATGGGATCCTCCCTATAGTGAGACAGAGGAACAA
ATCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACGGGATTCGACGAAAAGGGAAC
AACGGGATCTTCCTCTCAGAGGGACGTCGTGATACGAGGGCTCGGAGTAAAAGGGAAAAG
CAAGAAATAATTTATTCTTATTGA
GenBank Accession BX655924 [GenBank]
Graphic View Graphic view of sequence BX655924 of line 609E06
Predicted Position of Insertion Chr4:10114293 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) T9A21
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23