SimpleSearch - Line and FST details


Line specific information

 
Line ID 611A02
Vector Used pAC161
Line Availability only available from NASC (N458562)
Segregation Analysis 50:39:26
Confirmed for Hit At5g18450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g18450

 
Sequence (A. th genome BLAST matches underlined)
>09-K021888-022-611-A02-8409
GAAGCCATTTACATTGAATATATCCTGTGTGATGTATATCATGTATATGTTTTACACGTA
CACACTCATATTTACATTTGCCACGTAAGAATACGTATACTCCTGACGTGTCCTGTATAT
ATATACACACGCACACTTCAATTTTTCATTCACTAAACCAGATTTAATTTGAGACTCTCA
AAGAAACACCATGGAAGAAGAGCAACCTCCGGCCAAGAAACGAAACATGGGGAGATCTAT
GGGATCCTCCCTATAGTGAGACGTATTACTCACCGGTTTAGACGGAATTGGAAACACACT
GGATTAGTCGCTCTATGGAGACCCAAGGAAAATGCGATTTAAGGAGACTATGGAAATAGT
GAATAAAAGGTAAACGAAGTATCTTGGTATAAATGGAATTGTGTATAATTGAGAAAGAGA
AAATAAGAGAAA
GenBank Accession BX656050 [GenBank]
Graphic View Graphic view of gene At5g18450
Predicted Position of Insertion Chr5:6117173 - go to primer design
BLAST e Value 5e-101
Hit Clone Code (BAC ID) F20L16
Hit Gene Code At5g18450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX656051 [GenBank]


Last Updated on 14.10.2014 10:23