SimpleSearch - Line and FST details


Line specific information

 
Line ID 620A10
Vector Used pAC161
Line Availability only available from NASC (N459434)
Segregation Analysis 45:32:26
Confirmed for Hit At4g00050
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g00050

 
Sequence (A. th genome BLAST matches underlined)
>73-K021954-022-620-A10-8409
ATCCGGAATGAACCTTTACATTGAATATATCATGAAGATCTCAATAACACAAAACCTTTT
AACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACTGGATTATGCAGAATTGGTGA
CTCACTGGCTTCTGCCCCCTACGGAGTCCGCGCCACCACAGCCGCAGAGATCCCCATGTA
CATACCTTAATTTATCATCTTGATAGTATAAGTGGCCACAATATAATGATAGCTTTTCTT
GTTTGTCTTCACATTAAACTACATGGTATCCCAGCTAACATGGAAAATAATATCATATTG
CAACCCTCGTCACAATATAATGATGTAAATAAATA
GenBank Accession BX656809 [GenBank]
Graphic View Graphic view of gene At4g00050
Predicted Position of Insertion Chr4:17829 - go to primer design
BLAST e Value 7e-48
Hit Clone Code (BAC ID) F6N15
Hit Gene Code At4g00050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit K16E1

 
Sequence (A. th genome BLAST matches underlined)
>73-K021949-022-620-A10-8409
TTCAGACAAACTTAAAACCAAGCCAAGCTATGGGATCCTCCCTATAGTGAGAGCCAGTAC
ATCCGACATCTTGGCAGACGTAATGATCTGAACGATGTGCTAGGGAGAGTCGGGGGGGGG
GGGCAGATCATAATCAAAACATTTTGTGATGGGAACCGCCTGATATAGAGAGAAGCCGAA
AAGACCATAAAAAATAATATAAGTA
GenBank Accession FR813379 [GenBank]
Graphic View Graphic view of sequence FR813379 of line 620A10
Predicted Position of Insertion Chr5:17034074 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) K16E1
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03