SimpleSearch - Line and FST details


Line specific information

 
Line ID 620G05
Vector Used pAC161
Line Availability only available from NASC (N459501)
Segregation Analysis 50:48:29
Confirmed for Hit At3g53240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53240

 
Sequence (A. th genome BLAST matches underlined)
>39-K021954-022-620-G05-8409
CCGAGCATGGTCTGCCTTGTTGATACTTTTATCGACCGCGTAAAAGATGTACTGAGGATT
TATCTAAGGGAGCCTCCCAATAGTGAGTCGTATTACTCAATGGGGAACCCCAATGGGGTA
CCCCAATGAGGTAGCCCCATTATTGAGGCCGATAAGGAATAAAAGGAAGAAAGACCTTAA
AAACCATAAGGTGAGA
GenBank Accession BX656856 [GenBank]
Graphic View Graphic view of gene At3g53240
Predicted Position of Insertion Chr3:19738981 - go to primer design
BLAST e Value 5e-18
Hit Clone Code (BAC ID) T4D2
Hit Gene Code At3g53240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation receptor like protein 45
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23