SimpleSearch - Line and FST details


Line specific information

 
Line ID 625G11
Vector Used pAC161
Line Availability only available from NASC (N459987)
Segregation Analysis 50:34:31
Confirmed for Hit At4g39570
Parent of DUPLO pair none
Parent of pair(s) 5874, 10454, 11374, 72747, 72748

Gene hit At4g39570

 
Sequence (A. th genome BLAST matches underlined)
>87-K022320-022-625-G11-8409
GNAGCCATTTACATTGAATATATCCTGCTTTCAATCGACACCTCCAGCTACACCATATAA
GTGTTCGACATATAGACCCAAATTTGGGATCATAGGCCCATCCCTTACTGGGAGAAAGAC
TGGGGCGCTCTATCAAGAAGCGCGTATGTTGATGGAAAGTTCTACTTGACGATTGGGATG
AAGGTTATGGCTTATGATCTATGGGATCCTCCCTATAGTGAGGCTAAGTAATCCCCCCTA
TCGTCGGGATTTTAGATTCCCTATGACATCCTCCTTTTAGAGTTGCAAAAGAATTGGTCA
GTGAGCCTACCTAATAGAAAGGGATTGTAGGGCGCCATATAAAATAGGAAGAGGAAGGGG
GGGAAATCGAGATATTGAACATAAAAAGCTATGCGAAAGTGAATGTAGAACACTACGACA
TAGTGAGTACATGAGATTATATTATAGA
GenBank Accession BX657690 [GenBank]
Graphic View Graphic view of gene At4g39570
Predicted Position of Insertion Chr4:18384811 - go to primer design
BLAST e Value 5e-73
Hit Clone Code (BAC ID) F23K16
Hit Gene Code At4g39570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Galactose oxidase/kelch repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX657688 [GenBank]


Last Updated on 31.08.2016 09:40