SimpleSearch - Line and FST details


Line specific information

 
Line ID 626E06
Vector Used pAC161
Line Availability only available from NASC (N460054)
Segregation Analysis 50:27:23
Confirmed for Hit At5g49770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g49770

 
Sequence (A. th genome BLAST matches underlined)
>45-K022317-022-626-E06-8409
CTCGTTTCATTTAGATATCTTACGAATACAGAACAAATCTTTATTTGCTCACTTACAGTT
CTTGAAGATTTGTGAGATTATTAAGACTTGAAGGAATGTCTCCACTTAGTCTATTCCTAT
CAAGACGTCTGTAACAAAGCAAATATCTTATAAGATTAAAGAAATTTTGTGAACATACAG
TTTGGAAAATATATTTCTACTACTTACAACACAGTCAAATTTTGAACTATGGGATCCTCC
CTATAGTGAGACGAATTACACCCCCATTTGGAGGGAAATGTTGATCCTCTGCCAAACTCG
TTTTAGGAACACTCACTGATAAACCAACGGAGCCCCCTAAAAGGTAGACAAGGTCAATGC
GAGCATAAAGGGAG
GenBank Accession BX657803 [GenBank]
Graphic View Graphic view of gene At5g49770
Predicted Position of Insertion Chr5:20224455 - go to primer design
BLAST e Value 4e-117
Hit Clone Code (BAC ID) K2I5
Hit Gene Code At5g49770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX657804 [GenBank]


Last Updated on 07.07.2016 14:03