SimpleSearch - Line and FST details


Line specific information

 
Line ID 641G04
Vector Used pAC161
Line Availability only available from NASC (N461516)
Segregation Analysis 50:14:7
Confirmed for Hit At3g57910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g16860

 
Sequence (A. th genome BLAST matches underlined)
>31-K022259-022-641-G04-8409
ACATTGAATATACATGTGAAAACAATAATATGACCTAACATAAACACTATGGGATCCTCC
CTATAGTGAGTCGTATTAATCCCCCCTTTGGACGTGATTGTAGACCCGCTATGTGATCCT
CCCTAGAGAGTGTCAAATTGGGTTTACCCTTTTGGATTGAATG
GenBank Accession FR813822 [GenBank]
Graphic View Graphic view of gene At4g16860
Predicted Position of Insertion Chr4:9488720 - go to primer design
BLAST e Value 0.053
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance protein (TIR-NBS-LRR class) family
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit FR813824 [GenBank]

Gene hit At3g57910

 
Sequence (A. th genome BLAST matches underlined)
>31-K023211-022-641-G04-8409
TGAATAATACGCATTGACTTTACTACGCGGCCTATGGGATCCTCCCTATAGTGAGGCTAT
GGGATCCTCCCTATAATAACGCTGCGGACATCTACGTTTTTGAATTGAAAAAAACGGGCA
GGGGACCCCCCCCAAGGGGGAGGCTAGGGAACCCCCTGAGTAAAAGGCCAGGGACCGCTC
TTGTTAAGCAAGGCACTGGTAGAGCTGAGCCACCGACTATGGATATTCGAAGATCGAGAG
CCGGTGTGGGAAGAGAGGATCCACATAGGGAGAAGAAGACTAAGGAGGAGATTGAGGCTG
AGAACGAAAAGAGAGGAGAGGACGGGACGCCGCAGGAATAGGGACGGGGAGCGATCAGAA
CTAAGGGAGAGAGAGAAAAGACAAGAGCGCGCAA
GenBank Accession BX893120 [GenBank]
Graphic View Graphic view of gene At3g57910
Predicted Position of Insertion Chr3:21443114 - go to primer design
BLAST e Value 2e-48
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation D111/G-patch domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR813823 [GenBank]


Last Updated on 31.08.2016 09:40