SimpleSearch - Line and FST details


Line specific information

 
Line ID 659C02
Vector Used pGABI1
Line Availability only available from NASC (N463194)
Segregation Analysis 50:50:33
Confirmed for Hit At5g64380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64380

 
Sequence (A. th genome BLAST matches underlined)
>11-K021135-022-659-C02-8409
NNNNTTCGGACTGTATCCCGGAATGAACCATTTACATTGAATATATCCTGATGGCGAGAC
GCCATATCGCGACGGTTAATACTGGCGGTCGGAGCAGAGAGAACAGAAGCTGCGATTTGT
CTTAGCGGGTAAAGATTGAGTCTTGGCGGGGAAATTGGAGTTGGGTATGGGATCCTCCCT
ATAGTGAG
GenBank Accession BX660778 [GenBank]
Graphic View Graphic view of gene At5g64380
Predicted Position of Insertion Chr5:25741485 - go to primer design
BLAST e Value 3e-59
Hit Clone Code (BAC ID) MSJ1
Hit Gene Code At5g64380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Inositol monophosphatase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40