SimpleSearch - Line and FST details


Line specific information

 
Line ID 695F02
Vector Used pAC161
Line Availability only available from NASC (N466686)
Segregation Analysis 50:50:35
Confirmed for Hit At3g04730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g04730

 
Sequence (A. th genome BLAST matches underlined)
>14-K024553-022-695-F02-8409
AGCCCTTTTAAATGTGATCATCCTGGGTAATTATTTCTTTTACTCTATGGGATCCTCCCT
ATAGTGAGACTAATTTTGAGGCCACGGAGCTGAGATTAGGGCTACCGGGTGGGAATCACG
GAGGAGAAATGGCTGGAAAAAATAATGGTAAAAGAGGATTTTCTGAGACTGTTGATCTCA
AACTGAATCTTTCATCGACGGCTATGGATTCAGTTTCCAAAGTCGATTTAGAGAATATGA
AGGAGAAGGTCGTAAAACCACCAGCCAAGTAAGAAACTGAATTTCAATCTCTATTTCAAC
TAATAATATTGTCTTCTAGGTTCGCCACAATTAAGTGAGACTAGGCGGTCATTATGTAGA
GATGTATACGCTTTAACATGATTTCTAGGTATGGCACCCTCCCTAGAGTGAGAAGATCTG
CTGCTCCCTCGTACTCCAGTACTGGTTAGGACCAGGAAATGGTGAAAACCCCTATGGA
GenBank Accession BX944160 [GenBank]
Graphic View Graphic view of gene At3g04730
Predicted Position of Insertion Chr3:1290445 - go to primer design
BLAST e Value 2e-165
Hit Clone Code (BAC ID) F7O18
Hit Gene Code At3g04730 [TAIR] [MIPS] [SIGnAL]
Gene Annotation indoleacetic acid-induced protein 16
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23