SimpleSearch - Line and FST details


Line specific information

 
Line ID 700A12
Vector Used pGABI1
Line Availability only available from NASC (N467116)
Segregation Analysis 50:46:31
Confirmed for Hit At2g18410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g18410

 
Sequence (A. th genome BLAST matches underlined)
>89-K025069-022-700-A12-8409
ACATGAACCATTTACAATTGAATATATGCTGACCCTGAATATGAGGTGTACCTTCATTAA
GATTACTAGACGATTGGTCAGTGCATGCGAATGGAGTATGGGATCAATCCAAAATAGGAA
TCCTTCAGATCAAAACCAATTGTTATCAAACAAGTATCACAGTGATTCGAGCAATCAAAC
TACTCCACAAGCTAGGATAATATTTAGAAAACCTAATAACTCACCATTTAGAAGATGAAG
AGACAACGATTCCTTTTTGCTTCAACAATTGCAAATAGAACGAAGGGCTCCGCGAGAATG
TGATCAACACAAGACCCCTGAATCGCAAAGTGGGAAAAACGAAGACTTTAGCAGTAATGA
AGCAATTGGAGATCGAATATAGAAGAATTAGGGTTTAAGAGTATACTGCGACGAGGATTT
TCCAGCTAAAATTGAAGAAGATAGATTTGTGAGAAGATAGCCGGAGACATCGAGTCCGAA
AGGGGAAGCTACAGTTTCTTCTATAGTGAGAGCTGGTGCGAGTTCGCCTTCTTCACCACC
ATCTCTGAG
GenBank Accession BX944613 [GenBank]
Graphic View Graphic view of gene At2g18410
Predicted Position of Insertion Chr2:7991301 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T30D6
Hit Gene Code At2g18410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03