SimpleSearch - Line and FST details


Line specific information

 
Line ID 705H11
Vector Used pGABI1
Line Availability only available from NASC (N467679)
Segregation Analysis 50:50:37
Confirmed for Hit At3g14595
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g14595

 
Sequence (A. th genome BLAST matches underlined)
>88-K025107-022-705-H11-8409
ATTTTTTTGCTTAGTATTTTGAACATTGTGGATTCTTTTGTAAACAAACATCTAAATCTC
TTATCTCATCTGCCAGAATTTCTAGCTAAACTGTACCTTTCTCAAAAGGATTGTATCATT
ATTGCAACGTACGGGATCCTCACTATAGAGAGAGATAGATTTGTAGAGAGAGACTGGTGA
TTTCAGCGGGCATGCCCGTATGGGATCCTCCCTATAGTGAGACNNANNNNNNANNNNTNN
ANNNNNNAANGCAACNTCCNNCAAAATNCCTACANAAAAAAAACTCAATCACTTCAATAC
AACAAAACAATAATAACCCTTTACCTTTCATACCTCAACTCCCTTACACATCTCCAACAT
ANNAATCATACAAATCTCAAAAATAATACTTCACACCTTTCCACCTACAANCANAAACAA
ATCCATCCAAAC
GenBank Accession BX945146 [GenBank]
Graphic View Graphic view of gene At3g14595
Predicted Position of Insertion Chr3:4909588 - go to primer design
BLAST e Value 6e-45
Hit Clone Code (BAC ID) MIE1
Hit Gene Code At3g14595 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L18ae family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03