SimpleSearch - Line and FST details


Line specific information

 
Line ID 713E09
Vector Used pGABI1
Line Availability only available from NASC (N468409)
Segregation Analysis 50:50:30
Confirmed for Hit At1g25470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g25470

 
Sequence (A. th genome BLAST matches underlined)
>69-K022964-022-713-E09-8409
TAGTAATTTCCGGACTGAACCATTTACATTGAATATATCCTGCTAATTTCATTAATAGGC
AGATCAAGTTTACTGATAGAGGCAATTTAAAAAAGGATTTCATCAAGTTTGAGAAATTTT
ATTGATAGAAGGAAATCTACTAGGCAGTTTAAGTATCCTGTGGGAGTTAGGCCGAGGCCA
TCAGGCAAATTTGCTGCTGAGATTTTGAACCCATTCACTAAAACTAAGAAATGGTTGAGT
ACGAGATCCTCCCTATGGGGCGCCTCCTACACTGCACCCTACCATAGCTTGAATAACTGC
AAACACTCCCTAAAAAGTAATTATCTCCGCGAACAAGGAGACTCCGCCCTAGAGGGAGGT
CCATGATCTCTCTTACGCCAAACGGGGAATCTACTCAAAATCGTCGATCGCTCCAACTAC
TCCACCGAAGTA
GenBank Accession BX663446 [GenBank]
Graphic View Graphic view of gene At1g25470
Predicted Position of Insertion Chr1:8945622 - go to primer design
BLAST e Value 2e-57
Hit Clone Code (BAC ID) F2J7
Hit Gene Code At1g25470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AP2 domain-containing transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03