SimpleSearch - Line and FST details


Line specific information

 
Line ID 715A09
Vector Used pGABI1
Line Availability only available from NASC (N468553)
Segregation Analysis 50:49:38
Confirmed for Hit At5g03580
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g03580

 
Sequence (A. th genome BLAST matches underlined)
>65-K025039-022-715-A09-8409
ATGAAGCCATTTACATTGAATATATCCTGGCAGAGGATGCCATTTATTACAGCCTTCATT
GGTCGAACGATGTATGCGATACGATTGAGTACGCCGTGTATATTAATTGCCAGAACAGGG
AGCAGAGCGTATAAGAGCCCTAGATCACTTATCTGGCAATTACTCAATCTGTATTATAGA
GAGATATCGACCTTGTAGAGAAAGACGGGTGATCTCGACGGGCATGCATGTATGGGATCC
TCCCTCTCGTCGGGCAGGAGCTGCAACGTTAGCGTATAGTATTTGAGGGCGCGTATGGCA
CCCAAAAAATGTTGTGTCTGAGGTTTACGGATTTCGGAAAGGTTATAGAAATCAGTTCTA
TACAAAGATTTTAGAGGAGAGTCGCGAGGAGTTGCTTTCATTGATTATGAAAGTGAGGAA
ATCGCAGGACAAAGCTGGATTCCTATGAACGAATTGTTTAATACCCAAACCCATATGATG
TTGCTGGTAGATTTCTAATAAATATCACGGCCAACATATAGTTATACTGGTTACCTAACC
TACATTCTCTTCAGTTTTATAAT
GenBank Accession FR814935 [GenBank]
Graphic View Graphic view of gene At5g03580
Predicted Position of Insertion Chr5:907599 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) F12E4
Hit Gene Code At5g03580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA-binding (RRM/RBD/RNP motifs) family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814935 [GenBank]


Last Updated on 31.08.2016 09:40