SimpleSearch - Line and FST details


Line specific information

 
Line ID 742G06
Vector Used pAC161
Line Availability only available from NASC (N735698)
Segregation Analysis 23:22:3
Confirmed for Hit At2g47430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g47430

 
Sequence (A. th genome BLAST matches underlined)
>47-K023519-022-742-G06-8409
NTTTCGACGTAATCCGGAATGAAGCCATTTACAATTGCGCCTCCTGCTTCGATCTCCTGT
CTCACTTTCATGTCACTCACTGGAGGAGACTCTAATGTTGTCAATAAAACATTGAATTGG
AAACATGTTCCTTTCTCTCCCATGGCCTTGTCGGTGATTCTTATCTCCCCTCCCATTAAT
CTTACCTATAATAATAGACCACAAATGAAAACCATCTATGGGATCCTCCCTATAGTGAGT
CNTATTACTCN
GenBank Accession BX895506 [GenBank]
Graphic View Graphic view of gene At2g47430
Predicted Position of Insertion Chr2:19460544 - go to primer design
BLAST e Value 5e-98
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Signal transduction histidine kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23