SimpleSearch - Line and FST details


Line specific information

 
Line ID 747A04
Vector Used pAC161
Line Availability only available from NASC (N471620)
Segregation Analysis 50:18:11
Confirmed for Hit At2g19170
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g19170

 
Sequence (A. th genome BLAST matches underlined)
>25-K024638-022-747-A04-8409
TTTTTATTTGGGCTTTATTCGTGAAGAAGCCATTTACAATTGACATCATACTCATTGCTC
AGTTCTCTATTTCAGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACGGGGTTAG
ACTGAAATGGGAACTCAATGGGCTCGGCTATCTCGGGAGGGCTGCGGGGTGTCCCCTTGG
GGGAGATGAGCGCAATTATGTTGGTAGGGATTGATAGTATTGAAGCTAGGATGGGCCGGA
TATTATGCGGCAAAATACTCGCCGAGAGGAAATGGAGGGACAGTTGGAGCTACCAATTCA
GGGTAACCCA
GenBank Accession FR815258 [GenBank]
Graphic View Graphic view of gene At2g19170
Predicted Position of Insertion Chr2:8315155 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation subtilisin-like serine protease 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR815258 [GenBank]


Last Updated on 31.08.2016 09:40