SimpleSearch - Line and FST details


Line specific information

 
Line ID 756B11
Vector Used pAC161
Line Availability only available from NASC (N472503)
Segregation Analysis 60:52:41
Confirmed for Hit At2g14740
Parent of DUPLO pair none
Parent of pair(s) 84522, 84526, 84530, 84534, 84535, 84536

Gene hit At1g09460

 
Sequence (A. th genome BLAST matches underlined)
>82-K023801-022-756-B11-8409
TAAACTTAAACAATATAATCGCCCCTTATCCTTATAAAGACTCATATATACGAATAAAGG
AACTAACTACGGCTTAACACAGAAATTGTCCAATTCTTTCTCCTCATACATACCCTTATT
TTTAAACCTTATATTTCTCACATCCCAACTCAGATTTTGCAAAAAAAAAGTGTATACCCT
TACTCCTGTCAGTTGCTGCACGGTACTGACTACCTTATTTCTAAATGAACTTGAGTGACT
TCCTCACTAATTCAACGCCTAGAAACTTTTGCTATGATCTTCATCAACTTGGAAACAACA
ATCCTGAAACTTGATTTGTCCCACCAGTTTTGCTTGCACGCCGGCCCGACCTTCAGGGCG
AATGTTGTGCTATGGTACCCTCCCAATACTGAGAGTATTGCCATATCGGTTCACTCACCC
ATCTATGGCATCC
GenBank Accession FR815376 [GenBank]
Graphic View Graphic view of gene At1g09460
Predicted Position of Insertion Chr1:3055090 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) F14J9
Hit Gene Code At1g09460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Carbohydrate-binding X8 domain superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g14740

 
Sequence (A. th genome BLAST matches underlined)
>82-K023796-022-756-B11-8409
TTCCGCGAAGGAGCCATTTACAATTGATGGAATCCTCACTGTATGGTGCTTGAAGTCCCT
TACTGGCGTGAATCCCATGGGGTAAGGAGACTATGTATCACAGATTTCCCCCAGGTAACG
GATACGGTATCCATATAAATACTCTTCGCTATTACCACAGGGAAAGACGACGCATAACAA
GAAATTTGTCCAGCTTATCCTTCTCCTATATATGTATACTATGAACGCTCCAACTTCTGC
AAGTCCCACTGATACCTTGATACGCCAAAGGGCCGCCCCTGCTGATCTCACTTGTGGACC
CGTCTTGCCTATGGAATCCTCCCTATAGTGAGATGATTTCATCGCTAATTCAACGCCTAT
GGGATCCTCCCTATAGTGAGCTAAAATTCCGTGTAGCCCA
GenBank Accession BX896424 [GenBank]
Graphic View Graphic view of gene At2g14740
Predicted Position of Insertion Chr2:6312230 - go to primer design
BLAST e Value 1e-15
Hit Clone Code (BAC ID) T6B13
Hit Gene Code At2g14740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation vaculolar sorting receptor 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03