SimpleSearch - Line and FST details


Line specific information

 
Line ID 773C12
Vector Used pAC161
Line Availability available as T3 set from NASC (N474148)
Segregation Analysis 50:47:37
Confirmed for Hit At2g34340
Parent of DUPLO pair 11999
Parent of pair(s) none

Gene hit At2g34340

 
Sequence (A. th genome BLAST matches underlined)
>91-K024645-022-773-C12-8409
TTCGGAAGNAGCCATTTACAATTGAATATATCCATCGGAATTCGGTTCTTAGGTTAACCG
CGTTTTTTGGAGGCTTGAACCGTTACCGGTTTGCCATACTTCATCATCTTTTCCCAACTC
TTTTGTTTTTTTGCATATTACGGAAAATTGCTATGGGATCCTCCCTATAGTGAGACGTAT
TACTCCC
GenBank Accession BX947019 [GenBank]
Graphic View Graphic view of gene At2g34340
Predicted Position of Insertion Chr2:14489074 - go to primer design
BLAST e Value 9e-44
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation senescence regulator (Protein of unknown function, DUF584)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX947019 [GenBank]


Last Updated on 10.06.2021 13:37