SimpleSearch - Line and FST details


Line specific information

 
Line ID 793C12
Vector Used pAC161
Line Availability only available from NASC (N476068)
Segregation Analysis 50:50:41
Confirmed for Hit At2g17740
Parent of DUPLO pair none
Parent of pair(s) 4589, 7320, 8465, 8496, 95046

Gene hit At2g17740

 
Sequence (A. th genome BLAST matches underlined)
>91-K024938-022-793-C12-8409
GNAGCCATTTACAATTGAATATATCCTGATCACCCTTTGATCCTCCTCTATTCCCCACAG
AATAATAATTCAACGTATACTTGTGACGCATGCGGTGAGTATGGATCGGGGTTCACTTAC
AATTGTTCTATCTGCCAGTACGATGTTCATGTTGGATGTGTGTCTGTGCCTGAGACCATG
AAGCATGATGAGCACGTTCACCCGCTCGCTTTGATCTACAAGGCTCCATGCCCAAAGGAT
CATATATTTACCTGCGATGTTTGCGATGAAACTATGCCGCATAATCTGTGGTTGTACTAC
TGCCAGAAATGTGACTACGGTGCTCATTTACATTCATGCGTTGCTGAAGAAGAGGAAAAG
TCAAAGAAAGGAGGAAGAGGAAGAGGAGGAGAAAGAGGAATTGGCGCAAATGAAAAGAAA
CA
GenBank Accession BX948813 [GenBank]
Graphic View Graphic view of gene At2g17740
Predicted Position of Insertion Chr2:7707624 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17A5
Hit Gene Code At2g17740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine/Histidine-rich C1 domain family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03