SimpleSearch - Line and FST details


Line specific information

 
Line ID 797D03
Vector Used pAC161
Line Availability only available from NASC (N476455)
Segregation Analysis 50:50:34
Confirmed for Hit At3g59030
Parent of DUPLO pair none
Parent of pair(s) 3736, 3772, 3774, 86174, 86224, 86310

Gene hit At3g59030

 
Sequence (A. th genome BLAST matches underlined)
>20-K024951-022-797-D03-8409
CCGGACAGNACCATTTACAATTGAATATATCCTGCAGCTGCAAGGTGCAAGACCATGGCT
CGTTGGCAGATTATTCCCATTGATGAGTACTGTCTCGCTCCGTACGCTTGACCACACACT
GTTTGGACCGCGCTCGCCATTCCTAACTAGTCAATTTGATTAACAAAACTTTTTAAAACT
CAAGAATGTTCGATAAGGAGAAACCGATCAACATATGAAGTGTACAATAAATATAGAATT
AAACGACGTTGTTTCGTGTTCTTCACTCTGTTTTTTACTTTATGAACTCAAATGTGCCTT
CGTACCATGATACCGTAAGCTATGGGATCCTCCCTATAGTGAGACTTATTACTCCCCCCC
TTCTCCCTATC
GenBank Accession BX949258 [GenBank]
Graphic View Graphic view of gene At3g59030
Predicted Position of Insertion Chr3:21819715 - go to primer design
BLAST e Value 1e-163
Hit Clone Code (BAC ID) F17J16
Hit Gene Code At3g59030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation MATE efflux family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949259 [GenBank]


Last Updated on 14.10.2014 10:23