SimpleSearch - Line and FST details


Line specific information

 
Line ID 815E02
Vector Used pAC106
Line Availability only available from NASC (N478194)
Segregation Analysis 50:15:10
Confirmed for Hit At5g65060
Parent of DUPLO pair none
Parent of pair(s) 64861, 95390, 95391, 95392, 95393

Gene hit At5g65060

 
Sequence (A. th genome BLAST matches underlined)
>13-K025605-022-815-E02-8409
TATTCGGACATGAGCCATTTACTGTAGATTGCTGTCTATTTGTTAAATTTTGAGATTTGG
TTTGTATCCAATGTTGCAATGCACCTCCCGTGGATTTGTTGATAGAGTAATTGGGGTTAA
TGGTAACATTTACCAAGAGTCTTTCGTTTAAATTACATTGTGGAATTACTGATCCCGAAT
GTATTGTAGTCTAGACTACACTGATTGTTTTTAATTTCTCTCCAATGGATTTGCCGATTA
GGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR399150 [GenBank]
Graphic View Graphic view of gene At5g65060
Predicted Position of Insertion Chr5:25988141 - go to primer design
BLAST e Value 3e-114
Hit Clone Code (BAC ID) MXK3
Hit Gene Code At5g65060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23