SimpleSearch - Line and FST details


Line specific information

 
Line ID 858D04
Vector Used pAC161
Line Availability only available from NASC (N482312)
Segregation Analysis 50:38:29
Confirmed for Hit At1g63570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g63570

 
Sequence (A. th genome BLAST matches underlined)
>28-K025969-022-858-D04-8409
GNACATGAGCCATTTACAATTGAATATATCCTTGATGCTATATCCAACATCTGATAGCAT
TATATCAGAACGACGATATACTATCATCTACATATTCGAGCATGTGAATTGTCCACTTAC
ACATATGCCTTATTTAAACACTATTTTGAATCAATCAACAACGAAAAGCTCTTTTCATTC
CACAATAAATTCCCAATCTCCTCTGTTTCCTCCAACCATACAAAACAAAATGGCAAGAAT
CATACTCACTGCTCCTCTGTTTTACTTCTTCATTTCCTCGTTATCTCACCAAACCATGTC
CCAACCTCAACACATGCACACTTTCTGCAGCGTCGACGGCTTCACACAAACCACCTCCTA
CGAAACAAACCGCAACATCCTACTCACCACTCTCAGCTTGACTTCCTCGCTCGTATGGGA
TCCTCCCTATAGTGAGAGG
GenBank Accession CR402825 [GenBank]
Graphic View Graphic view of gene At1g63570
Predicted Position of Insertion Chr1:23575258 - go to primer design
BLAST e Value 4e-126
Hit Clone Code (BAC ID) F2K11
Hit Gene Code At1g63570 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Receptor-like protein kinase-related family protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23