SimpleSearch - Line and FST details


Line specific information

 
Line ID 859F04
Vector Used pAC161
Line Availability available as T3 set from NASC (N482432)
Segregation Analysis 50:10:7
Confirmed for Hit At2g46660
Parent of DUPLO pair none
Parent of pair(s) 571, 4188, 4286, 8405, 92262

Gene hit At2g46660

 
Sequence (A. th genome BLAST matches underlined) 
>30-K025970-022-859-F04-8409
TATTCAGAAGAAAAGACGCAGTTGCGGTCTTAATCGAGTGGATCCTCGCTAGGATGGTCC
TTCATCCAGATATGCAATCAACGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR402985 [GenBank]
Graphic View Graphic view of gene At2g46660
Predicted Position of Insertion Chr2:19154212 - go to primer design
BLAST e Value 3e-34
Hit Clone Code (BAC ID) F13A10
Hit Gene Code At2g46660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 78, subfamily A, polypeptide 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37