Sequences from confirmation amplicon


Confirmation sequences for line 085F04 and hit At1g76580 are shown.
Line ID 085F04
Locus At1g76580 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:28736337
Primers used for PCR PH82 - 8474, show primer details
   
Sequence Name 59-K018063-022-085-F04C-PH82
GenBank Accession LN509854 [GenBank]
Sequencing primer gene specific primer, PH82: 5'-TCCATCTCAGTATTCAGATTCACG-3'
Sequence (A. th genome BLAST matches underlined)
>59-K018063-022-085-F04C-PH82
CTTATCTCTACAACTATTCACCTCTTCACCAGAAGAGGAGAGTCGACCAAAAGTTGCATC
TTCAACAAAGTATTATTCTTCTGCGAGCAGTAACCCTGTTGAGGATAGATCACCATCATC
ATCTCCAGTCATGCAAGAGTTATTCCCTTTGCATACTTCTCCTGAAACCAGGAGGTATAA
CAATTACAAAGACACTAGTACCAGTCCCAGGACCAGTTGTTTGCCCCTAGAGCTCTTTGG
TGCATCAAATAGAGGAGCTACTGCAAATCCTAATTACAATGTTTTGAGGCATCAATCTGG
TTATGCTTCATCTGGTTCGGATTATTCTCCTCCTAGCTTAAACTCTAATGCTCAGGTATG
CTGCTACCCATATTCTATTTGTAAACTAAACTCAAGGTCTTAGCAAAGCAGCAATGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCAC
G
   
Sequence Name 63-K018063-022-085-F04C-8409
GenBank Accession LN510876 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>63-K018063-022-085-F04C-8409
CCGGACATGAAGCCATTTACATTGCTGCTTTGCTAAGACCTTGAGTTTAGTTTACAAATA
GAATATGGGTAGCAGCATACCTGAGCATTAGAGTTTAAGCTAGGAGGAGAATAATCCGAA
CCAGATGAAGCATAACCAGATTGATGCCTCAAAACATTGTAATTAGGATTTGCAGTAGCT
CCTCTATTTGATGCACCAAAGAGCTCTAGGGGCAAACAACTGGTCCTGGGACTGGTACTA
GTGTCTTTGTAATTGTTATACCTCCTGGTTTCAGGAGAAGTATGCAAAGGGAATAACTCT
TGCATGACTGGAGATGATGATGGTGATCTATCCTCAACAGGGTTACTGCTCGCAGAAGAA
TAATACTTTGTTGAAGATGCAACTTTTGGTCGACTCTCCTCTTCTGGTGAAGAGGTGAAT
AGTTGTAGAGATAAGCTCGATCTAGTGTCTTGACCGCGTGAATCTGAATAC

Last Updated on 23.10.2014 13:25