SimpleSearch - Line and FST details


Line specific information

 
Line ID 085F04
Vector Used pAC161
Line Availability only available from NASC (N408128)
Segregation Analysis 87:60:38
Confirmed for Hit At1g76580
Parent of DUPLO pair 219
Parent of pair(s) none

Gene hit At1g76580

 
Sequence (A. th genome BLAST matches underlined)
>30-011846-strizhov-F4-35St
TGACGTAAGGGATNGACGCACAATCCCCTATCCTTCGCAAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTT
CGGTTTAAACTATCACTTTTATGGGTTTGTAAACAGGAGCGCACAGGAAAGATATCTTTC
AAACTATTTGAAAAAGATCCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession BX511277 [GenBank]
Graphic View Graphic view of gene At1g76580
Predicted Position of Insertion Chr1:28736347 - go to primer design
BLAST e Value 5e-31
Hit Clone Code (BAC ID) F14G6
Hit Gene Code At1g76580 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX511276 [GenBank]


Last Updated on 14.10.2014 10:23