Sequences from confirmation amplicon


Confirmation sequences for line 393A05 and hit At2g15830 are shown.
Line ID 393A05
Locus At2g15830 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:6894047
Primers used for PCR CM11 - 8474, show primer details
   
Sequence Name 16-K024506-022-393-A05C-CM11
GenBank Accession LN493267 [GenBank]
Sequencing primer gene specific primer, CM11: 5'-GGACTACGGTCTGGAAAACAAATA-3'
Sequence (A. th genome BLAST matches underlined)
>16-K024506-022-393-A05C-CM11
ACGGTAGTGAAACGCTGCAAGCCGTGATACCATTGGAATTTCGGCCGGGGACAAATATAA
CCTCTTCTTCTAAAATAGAACTAGAAAGTCTTACGTTGCAGTTAAACTAAAGTAACCAAG
AGTCAAAAGATAAGACGCAACAGTGTTAATTATTTTGTTTTTCCTCTGTCACATTTAGTC
GCGTAAACTATGCACCGAACAAGACTAAAATTCACGAGAGGCATGGGTCTTCCCCTATTT
AGGACGGTGCAAGATTTAGATAAAGAGAGAGAGGGACGTTGCTTTAAGGCAAAAAAAGCA
AATCAAATAGTATTTTCTTGTTGTCAGGATTCATGAACCACAAAAAGTGGAAAAATAATT
AAGGAATGCAATTGGAAGAATGAATATATTTTTTGTAATTCCGAAAACTCATGAAATATA
ATAAGATTTTCTTATAGTTGCGAATAATTAAAACCTGTAAACCCACAGAAACAGTCAGCC
AATTATTTTAAATTTTCAACTTTTTAATTTAGAATACTTTATTCAAAAAAAAGTCAAAAC
ACGTTATACAATAGTTTTTCTTTCAAGTTATAGATAGAATATTCAAAAATGGCTTCATGT
CCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAG
NTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATG
AAAGTACATTTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAAT
AAACAAATTATTCTAATTCGGAAATCTTTAT
   
Sequence Name 15-K024506-022-393-A05C-8409
GenBank Accession LN492798 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K024506-022-393-A05C-8409
GTAGATTTCCCGGACATGAAGCCATTTTTGAATATTCTATCTATAACTTGAAAGAAAAAC
TATTGTATAACGTGTTTTGACTTTTTTTTGAATAAAGTATTCTAAATTAAAAAGTTGAAA
ATTTAAAATAATTGGCTGACTGTTTCTGTGGGTTTACAGGTTTTAATTATTCGCAACTAT
AAGAAAATCTTATTATATTTCATGAGTTTTCGGAATTACAAAAAATATATTCATTCTTCC
AATTGCATTCCTTAATTATTTTTCCACTTTTTGTGGTTCATGAATCCTGACAACAAGAAA
ATACTATTTGATTTGCTTTTTTTGCCTTAAAGCAACGTCCCTCTCTCTCTTTATCTAAAT
CTTGCACCGTCCTAAATAGGGGAAGACCCATGCCTCTCGTGAATTTTAGTCTTGTTCGGT
GCATAGTTTACGCGACTAAATGTGACAGAGGAAAAACAAAATAATTAACACTGTTGCGTC
TTATCTTTTGACTCTTGGTTACTTTAGTTTAACTGCAACGTAAGACTTTCTAGTTCTATT
TTAGAAGAAGAGGTTATATTTGTCCCCGGCCGAAATTCCAATGGTATCACGGCTTGCAGC
GTTTCACTACCGTGATATTTGTTT
Primers used for PCR CM12 - 8474, show primer details
   
Sequence Name 25-K024507-022-393-A05C-8409
GenBank Accession LN497276 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K024507-022-393-A05C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTCACATGGCATGCATGTTTGAC
TTTATATAAATACCGAAGAAGATGGAGTAAGAATTTGACGGTAGAGACGAAAGAAAAAAA
AAGAAGCAAAACAAAATAGAGAAAGAGAAAGAAAGAGAGGATGGTGATAAAGAAAATCGA
GCTATGCATAGAGATTACGAAGATAACAATGGAGTTCTTGGTGGTGGTGGCTGACGCCGT
CACAATCTTCTTAAGGCAATCTTCTCCACCTCCTCCGGCTCTACTCCGCCATGGTCTCTA
CTCATACTCTGCCTCCCCTAATCCTCCTTCTTCCCATTACATCATCGGCTTTCTTCCCTA
AGTTTGTAATCGTTTCGTTTTAATGCTTTGTACATACTATACATATGTATATTCTTGCCT
TTTTTTTTATAATGAATGTCCTTGTATATTAATTTCTTAATTTTCGAATAAATCACCTCT
CACCTTACTTTCTCTATATGTATGTTTATTTTTATAAACAAGAACTAGTTTTTAGCCATT
CTCATACGTTATCACACTAGAGTTTTTAACTGTTTGTTTCGCTCTTAGATTGTTAGAATT
CGATGTGGAAAAGAAAAATGAAACCCATGATTATCATATTAACATATTGTTCCAAGATAT
TTTCAAATTAGAACATATCTAAATAAAACAAAAGTGGGGATAAAAAATGGAA
   
Sequence Name 26-K024507-022-393-A05C-CM12
GenBank Accession LN497752 [GenBank]
Sequencing primer gene specific primer, CM12: 5'-CGTCTTATTCGTCAACCTCTTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K024507-022-393-A05C-CM12
CATTTTTTATCCCCACTTTTGTTTTATTTAGATATGTTCTAATTTGAAAATATCTTGGAA
CAATATGTTAATATGATAATCATGGGTTTCATTTTTCTTTTCCACATCGAATTCTAACAA
TCTAAGAGCGAAACAAACAGTTAAAAACTCTAGTGTGATAACGTATGAGAATGGCTAAAA
ACTAGTTCTTGTTTATAAAAATAAACATACATATAGAGAAAGTAAGGTGAGAGGTGATTT
ATTCGAAAATTAAGAAATTAATATACAAGGACATTCATTATAAAAAAAAAGGCAAGAATA
TACATATGTATAGTATGTACAAAGCATTAAAACGAAACGATTACAAACTTAGGGAAGAAA
GCCGATGATGTAATGGGAAGAAGGAGGATTAGGGGAGGCAGAGTATGAGTAGAGACCATG
GCGGAGTAGAGCCGGAGGAGGTGGAGAAGATTGCCTTAAGAAGATTGTGACGGCGTCAGC
CACCACCACCAAGAACTCCATTGTTATCTTCGTAATCTCTATGCATAGCTCGATTTTCTT
TATCACCATCCTCTCTTTCTTTCTCTTTCTCTATTTTGTTTTGCTTCTTTTTTTTTCTTT
CGTCTCTACCGTCAAATTCTTACTCCATCTTCTTCGGTATTTATATAAAGTCAAACATGC
ATGCCATGTGAATATTCAA

Last Updated on 23.10.2014 13:25