SimpleSearch - Line and FST details


Line specific information

 
Line ID 393A05
Vector Used pAC161
Line Availability only available from NASC (N437637)
Segregation Analysis 50:49:38
Confirmed for Hit At2g15830
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g15830

 
Sequence (A. th genome BLAST matches underlined)
>33-K018296-022-393-A05-8409
ATGAACCATTTTTGAATATTCTATCTATAACTTGCAATATAATCTCTTGTATAACCTGTT
TTCACTTTTGTTTGAATATTCATTCTAAATTAGAAAGGTCAAGATTTAGAATAAGTGATT
GACTGTTTCTGCGGACTTACAGGTTGTTATTATTCCCAACCATGAGATATTCTTATTTTA
TTGCAAGAGCTTCCGGAATTACGATGCTCATCTTCGTTCTTCCGATCTGCTTCCTTACTC
ATTTTTCCACTTTTTGTGGTTCATGAATCCTGCCACTATAAAATACATATTCGATTTGCT
TTTTTCGCCTTATAGCACACTACCCTCTCTCTCTTTATCCAAATCTTGCGCCGTCGTAAT
TAGGGGAAGACCCCTGCCTCTACCCATTGTTGAACTTGCTCGGTTGCCCTTTGACCCGAC
GAGACTGGACCTATGATATTCTAGGTATTTACCACTGTGGCGTGCTCCCTCTTGACTCTG
GGTATCTTCTTCTTGACTGCAACGCAAAACTTTCTCTGGACCACGCCNNNNAAAAGGGGG
TTACGGGAGAGTTCTGTTTAGGTCCTCTATTTGAATCTTTGACTCCATGGGAATTGGGGA
TCCTCTATGG
GenBank Accession BX286685 [GenBank]
Graphic View Graphic view of gene At2g15830
Predicted Position of Insertion Chr2:6894055 - go to primer design
BLAST e Value 9e-45
Hit Clone Code (BAC ID) F19G14
Hit Gene Code At2g15830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX286685 [GenBank]


Last Updated on 31.08.2016 09:40