SimpleSearch - Line and FST details


Line specific information

 
Line ID 037C03
Vector Used pAC161
Line Availability only available from NASC (N403483)
Segregation Analysis 50:50:40
Confirmed for Hit At3g47810 At5g12920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g47810

Sequence (A. th genome BLAST matches underlined)
>19-K015039-022-037-C03-8409
TTGTCCATGTAGATTTCCCGGACTGAAGCACTTACAATTGAATATTATTCAAGCCTGTTA
AATTATATGCAAAAAACAAGCGAGCCAACGCTGAAACTCACTGGGTAAGGGACACACACC
AACAAAGCAATGAAGTAAAGGCAAGCAAAATTTGGTTTTCTAGTCTGAGAATTCTGATAA
ACAGATGATGTATGATACGAGGGATTATTCGTATGCTGCAAATGCTATGGGATCCTCCCT
TTAAGTGAGACNNNNNNTTACTGNAATTNNAATGATCTNAATAACTTTAATGGGCTTGGG
GATATTTAACTTTATG
GenBank Accession AL763476 [GenBank]
Graphic View Graphic view of gene At3g47810
Predicted Position of Insertion Chr3:17637871 - go to primer design
BLAST e Value 6e-83
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcineurin-like metallo-phosphoesterase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Shimada et al. 2006, mag1-2]

Gene hit At5g12920

 
Sequence (A. th genome BLAST matches underlined)
>19-K015009-022-037-C03-8409
GATCATGAAATTTCCCGGACATGAAGCCATTTACCTTCATTCTTGTGTTCTCTGGCTCTG
ATCACGTTATGATATTGGTAACGTTCAGATGAGCCAATTGCCTTTAGCATCTCTACATCT
TGCACCGAAGCTGCAGAAAATTGCATCTCTTAAGGTAAGTTCTGACTTTTGTTTTCCATT
TCACTTGATTCATCGTTCAGCAACCTTTTTCTGCTTCTTTGGTTTTTTTTTTTTAAAAAA
AAAATTTGAAAGGGGAAAATTTTTTCCCCCCCAAATTTCCCAAAAATTTTACCGCTTAAA
TTTTTGGAACACTAAAAAAAAATTCCATGAAAAATTTTTAGGGGAAGACAAAA
GenBank Accession AL763475 [GenBank]
Graphic View Graphic view of gene At5g12920
Predicted Position of Insertion Chr5:4079370 - go to primer design
BLAST e Value 8e-101
Hit Clone Code (BAC ID) T24H18
Hit Gene Code At5g12920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03