GABI-Kat confirmation strategy

 

After we receive an user request for a given insertion, the FST-based prediction of the insertion site is confirmed by sequencing an amplicon from the respective locus spanning the fusion between plant genomic DNA and the T-DNA. The figure below gives an overview over the generation of confirmation sequences.

 

The figure applies to the confirmation of FSTs that were created at the left border (LB) with the primer o8409. In case of right border (RB) FSTs, o3144/35St is used instead of o8474 and o8409 in both the confirmation PCR and amplicon sequencing. The result obtained from sequencing the confirmation amplicon is compared to the FST prediction, and if the two sequences match the insertion allele is considered "confirmed", and the respective line is delivered.

 

Primer nameSequence (5' to 3')
o3144/35St GTGGATTGATGTGATATCTCC
o8409 ATATTGACCATCATACTCATTGC
o8474 ATAATAACGCTGCGGACATCTACATTTT
 

 

 

The following temperature profile is used in the confirmation PCR:

 

94 °C 2 min
94 °C 30 sec
59 °C 30 sec 37 cycles
72 °C 90 sec
72 °C 5 min
15 °C for ever
 
 
 
 
 

 

Note 1: The gene specific primer is designed with a tm of 60 °C.
Note 2: Usually both sequences, the sequence generated with the gene specific primer and the one generated with the border primer give the same result. Nevertheless, if only one sequence matches to the FST, the insertion is regarded as confirmed.