General GABI-Kat sequencing strategy
The figure below gives an overview on how we create the sequences which are primed from the T-DNA present in pAC161 (a map and the sequence of the binary vector pAC161 is available from the download page). To orient a (potential) insertion sequence relative to YFG (your favorite gene), you need to figure out which primer has been used in the sequencing reaction. The name of the primer is given at the end of the name of the sequence (displayed in FASTA format in the sequence window).
Example: primer o8409 was used to generate the sequence 65-K012471-022-054-A09-8409
Info on the oligos used to build the adapter which is ligated to the BfaI overhang | ||
|
sequence (5' to 3') |
comment |
---|---|---|
long adapter oligo |
GAGTAATACGACTCACTATAGGGAGGATCCCA |
contains annealing site for "green" primer |
short adapter oligo |
TATGGGATCACATTAA(3dC) |
blocked 3'-end to avoid extension |
BfaI site: C'TA_G |
(only 7 bases form ds-DNA, plus 2 from overhang) |
Info on the oligos used as primers in the sequence reaction (dark-red in the picture above) | ||
---|---|---|
sequencing primer name |
sequence (5' to 3') |
reading out of which border? |
o8409 |
ATATTGACCATCATACTCATTGC |
Left |
o3144 |
GTGGATTGATGTGATATCTCC |
Right |
oriL |
ATATTGACCATCATACTCATTGC |
Left |
35St |
GTGGATTGATGTGATATCTCC |
Right |